Post Categories Uncategorized Post dateJuly 26, 2024Post last updated dateUpdated July 26, 2024 Anti-SOST / Sclerostin Reference Antibody (setrusumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-SOST / Sclerostin Reference Antibody (setrusumab)synonym : null,productDescription : Anti-SOST /...
Post Categories Uncategorized Post dateJuly 26, 2024Post last updated dateUpdated July 26, 2024 Anti-RSPO3 Reference Antibody (rosmantuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-RSPO3 Reference Antibody (rosmantuzumab)synonym : null,productDescription : Anti-RSPO3 Reference Antibody (rosmantuzumab)(CHA333)...
Post Categories Uncategorized Post dateJuly 26, 2024Post last updated dateUpdated July 26, 2024 Anti-RSPO1 Reference Antibody (Oncomed patent anti-RSPO1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-RSPO1 Reference Antibody (Oncomed patent anti-RSPO1)synonym : null,productDescription : Anti-RSPO1 Reference...
Post Categories Uncategorized Post dateJuly 25, 2024Post last updated dateUpdated July 25, 2024 Anti-MSPR / RON / CD136 Reference Antibody (narnatumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MSPR / RON / CD136 Reference Antibody (narnatumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 25, 2024Post last updated dateUpdated July 25, 2024 Anti-TNFSF11 / RANKL / CD254 Reference Antibody (denosumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF11 / RANKL / CD254 Reference Antibody (denosumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 25, 2024Post last updated dateUpdated July 25, 2024 Anti-AGER / RAGE Reference Antibody (XT-M4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-AGER / RAGE Reference Antibody (XT-M4)synonym : null,productDescription : Anti-AGER /...
Post Categories Uncategorized Post dateJuly 24, 2024Post last updated dateUpdated July 24, 2024 Anti-PVRIG Reference Antibody (COM701) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-PVRIG Reference Antibody (COM701)synonym : null,productDescription : Anti-PVRIG Reference Antibody (COM701)(CHA328)...
Post Categories Uncategorized Post dateJuly 24, 2024Post last updated dateUpdated July 24, 2024 Anti-PVRIG Reference Antibody (GSK4381562) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-PVRIG Reference Antibody (GSK4381562)synonym : null,productDescription : Anti-PVRIG Reference Antibody (GSK4381562)(CHA327)...
Post Categories Uncategorized Post dateJuly 24, 2024Post last updated dateUpdated July 24, 2024 Anti-PSCA Reference Antibody (AGS-1C4D4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PSCA Reference Antibody (AGS-1C4D4)synonym : null,productDescription : Anti-PSCA Reference Antibody (AGS-1C4D4)(CHA326)...
Post Categories Uncategorized Post dateJuly 23, 2024Post last updated dateUpdated July 23, 2024 Anti-Transferrin receptor / CD71 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Transferrin receptor / CD71 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight :...
Post Categories Uncategorized Post dateJuly 23, 2024Post last updated dateUpdated July 23, 2024 Anti-PRAME Reference Antibody (Eureka patent anti-PRAME) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-PRAME Reference Antibody (Eureka patent anti-PRAME)synonym : null,productDescription : Anti-PRAME Reference...
Post Categories Uncategorized Post dateJuly 23, 2024Post last updated dateUpdated July 23, 2024 Anti-PLA2G1B Reference Antibody (Diaccurate patent anti-sPLA2-GIB) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PLA2G1B Reference Antibody (Diaccurate patent anti-sPLA2-GIB)synonym : null,productDescription : Anti-PLA2G1B Reference...
Post Categories Uncategorized Post dateJuly 22, 2024Post last updated dateUpdated July 22, 2024 Anti-PGLYRP1 / PGRP-S Reference Antibody (Novo Nordisk patent anti-PGLYRP1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PGLYRP1 / PGRP-S Reference Antibody (Novo Nordisk patent anti-PGLYRP1)synonym : null,productDescription...
Post Categories Uncategorized Post dateJuly 22, 2024Post last updated dateUpdated July 22, 2024 Anti-PDGFRB / CD140b Reference Antibody (rinucumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-PDGFRB / CD140b Reference Antibody (rinucumab)synonym : null,productDescription : Anti-PDGFRB /...
Post Categories Uncategorized Post dateJuly 22, 2024Post last updated dateUpdated July 22, 2024 Anti-PDGFRA / CD140a Reference Antibody (olaratumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDGFRA / CD140a Reference Antibody (olaratumab)synonym : null,productDescription : Anti-PDGFRA /...
Post Categories Uncategorized Post dateJuly 21, 2024Post last updated dateUpdated July 21, 2024 Anti-PDGFRA / CD140a Reference Antibody (tovetumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDGFRA / CD140a Reference Antibody (tovetumab)synonym : null,productDescription : Anti-PDGFRA /...
Post Categories Uncategorized Post dateJuly 21, 2024Post last updated dateUpdated July 21, 2024 Anti-PDGFC / VEGFE Reference Antibody (Thrombogenics patent anti-PDGF-C) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDGFC / VEGFE Reference Antibody (Thrombogenics patent anti-PDGF-C)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 21, 2024Post last updated dateUpdated July 21, 2024 Anti-PCSK9 Reference Antibody (alirocumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-PCSK9 Reference Antibody (alirocumab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (alirocumab)(CHA316)...
Post Categories Uncategorized Post dateJuly 20, 2024Post last updated dateUpdated July 20, 2024 Anti-TNFSF4 / OX40L / CD252 Reference Antibody (oxelumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF4 / OX40L / CD252 Reference Antibody (oxelumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 20, 2024Post last updated dateUpdated July 20, 2024 Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (tavolixizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (tavolixizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 20, 2024Post last updated dateUpdated July 20, 2024 Anti-CD68 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-CD68 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJuly 19, 2024Post last updated dateUpdated July 19, 2024 Anti-NRP1 / VEGF165R / CD304 Reference Antibody (vesencumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-NRP1 / VEGF165R / CD304 Reference Antibody (vesencumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 19, 2024Post last updated dateUpdated July 19, 2024 Anti-NOTCH1 Reference Antibody (brontictuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-NOTCH1 Reference Antibody (brontictuzumab)synonym : null,productDescription : Anti-NOTCH1 Reference Antibody (brontictuzumab)(CHA312)...
Post Categories Uncategorized Post dateJuly 19, 2024Post last updated dateUpdated July 19, 2024 Anti-RTN4 / NOGO Reference Antibody (ozanezumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-RTN4 / NOGO Reference Antibody (ozanezumab)synonym : null,productDescription : Anti-RTN4 /...
Post Categories Uncategorized Post dateJuly 18, 2024Post last updated dateUpdated July 18, 2024 Anti-NKG2A / CD94 Reference Antibody (monalizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-NKG2A / CD94 Reference Antibody (monalizumab)synonym : null,productDescription : Anti-NKG2A /...
Post Categories Uncategorized Post dateJuly 18, 2024Post last updated dateUpdated July 18, 2024 Anti-NGF / bNGF Reference Antibody (tanezumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-NGF / bNGF Reference Antibody (tanezumab)synonym : null,productDescription : Anti-NGF /...
Post Categories Uncategorized Post dateJuly 18, 2024Post last updated dateUpdated July 18, 2024 Anti-NGF / bNGF Reference Antibody (fulranumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-NGF / bNGF Reference Antibody (fulranumab)synonym : null,productDescription : Anti-NGF /...
Post Categories Uncategorized Post dateJuly 17, 2024Post last updated dateUpdated July 17, 2024 Anti-GDF8 / Myostatin Reference Antibody (trevogrumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GDF8 / Myostatin Reference Antibody (trevogrumab)synonym : null,productDescription : Anti-GDF8 /...
Post Categories Uncategorized Post dateJuly 17, 2024Post last updated dateUpdated July 17, 2024 Anti-GDF8 / Myostatin Reference Antibody (landogrozumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GDF8 / Myostatin Reference Antibody (landogrozumab)synonym : null,productDescription : Anti-GDF8 /...
Post Categories Uncategorized Post dateJuly 17, 2024Post last updated dateUpdated July 17, 2024 Anti-MUC16 Reference Antibody (sofituzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-MUC16 Reference Antibody (sofituzumab)synonym : null,productDescription : Anti-MUC16 Reference Antibody (sofituzumab)(CHA305)...
Post Categories Uncategorized Post dateJuly 16, 2024Post last updated dateUpdated July 16, 2024 Anti-MUC16 Reference Antibody (oregovomab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MUC16 Reference Antibody (oregovomab)synonym : null,productDescription : Anti-MUC16 Reference Antibody (oregovomab)(CHA304)...
Post Categories Uncategorized Post dateJuly 16, 2024Post last updated dateUpdated July 16, 2024 Anti-CD63 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD63 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 26endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJuly 16, 2024Post last updated dateUpdated July 16, 2024 Anti-MUC1 Reference Antibody (clivatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MUC1 Reference Antibody (clivatuzumab)synonym : null,productDescription : Anti-MUC1 Reference Antibody (clivatuzumab)(CHA303)...
Post Categories Uncategorized Post dateJuly 15, 2024Post last updated dateUpdated July 15, 2024 Anti-MU5AC Reference Antibody (ensituximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MU5AC Reference Antibody (ensituximab)synonym : null,productDescription : Anti-MUC5AC Reference Antibody (ensituximab)(CHA302)...
Post Categories Uncategorized Post dateJuly 15, 2024Post last updated dateUpdated July 15, 2024 Anti-MMP9 Reference Antibody (andecaliximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MMP9 Reference Antibody (andecaliximab)synonym : null,productDescription : Anti-MMP9 Reference Antibody (andecaliximab)(CHA301)...
Post Categories Uncategorized Post dateJuly 15, 2024Post last updated dateUpdated July 15, 2024 Anti-MIF Reference Antibody (imalumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MIF Reference Antibody (imalumab)synonym : null,productDescription : Anti-MIF Reference Antibody (imalumab)(CHA300)...
Post Categories Uncategorized Post dateJuly 14, 2024Post last updated dateUpdated July 14, 2024 Anti-Mesothelin Reference Antibody (anetumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Mesothelin Reference Antibody (anetumab)synonym : null,productDescription : Anti-Mesothelin Reference Antibody (anetumab)(CHA299)...
Post Categories Uncategorized Post dateJuly 14, 2024Post last updated dateUpdated July 14, 2024 Anti-Mesothelin Reference Antibody (amatuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Mesothelin Reference Antibody (amatuximab)synonym : null,productDescription : Anti-Mesothelin Reference Antibody (amatuximab)(CHA298)...
Post Categories Uncategorized Post dateJuly 14, 2024Post last updated dateUpdated July 14, 2024 Anti-MER / MERTK Reference Antibody (RGX-019) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MER / MERTK Reference Antibody (RGX-019)synonym : null,productDescription : Anti-MER /...
Post Categories Uncategorized Post dateJuly 13, 2024Post last updated dateUpdated July 13, 2024 Anti-MASP2 Reference Antibody (narsoplimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MASP2 Reference Antibody (narsoplimab)synonym : null,productDescription : Anti-MASP2 Reference Antibody (narsoplimab)(CHA296)...
Post Categories Uncategorized Post dateJuly 13, 2024Post last updated dateUpdated July 13, 2024 Anti-MAGEA3 Reference Antibody (CT Atlantic patent anti-MAGE-A3) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MAGEA3 Reference Antibody (CT Atlantic patent anti-MAGE-A3)synonym : null,productDescription : Anti-MAGEA3...
Post Categories Uncategorized Post dateJuly 13, 2024Post last updated dateUpdated July 13, 2024 Anti-Siglec-4a / MAG Reference Antibody (refanezumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-4a / MAG Reference Antibody (refanezumab)synonym : null,productDescription : Anti-Siglec-4a /...
Post Categories Uncategorized Post dateJuly 12, 2024Post last updated dateUpdated July 12, 2024 Anti-CD61 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD61 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 87endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJuly 12, 2024Post last updated dateUpdated July 12, 2024 Anti-MADCAM1 Reference Antibody (ontamalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MADCAM1 Reference Antibody (ontamalimab)synonym : null,productDescription : Anti-MADCAM1 Reference Antibody (ontamalimab)(CHA292)...
Post Categories Uncategorized Post dateJuly 12, 2024Post last updated dateUpdated July 12, 2024 Anti-LOXL2 Reference Antibody (simtuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-LOXL2 Reference Antibody (simtuzumab)synonym : null,productDescription : Anti-LOXL2 Reference Antibody (simtuzumab)(CHA290)...
Post Categories Uncategorized Post dateJuly 11, 2024Post last updated dateUpdated July 11, 2024 Anti-LILRB2 / ILT4 / CD85d Reference Antibody (JTX-8064) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-LILRB2 / ILT4 / CD85d Reference Antibody (JTX-8064)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 11, 2024Post last updated dateUpdated July 11, 2024 Anti-Lewis Y Reference Antibody (MB 311) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Lewis Y Reference Antibody (MB 311)synonym : null,productDescription : Anti-Lewis Y...
Post Categories Uncategorized Post dateJuly 11, 2024Post last updated dateUpdated July 11, 2024 Anti-LEPR / CD295 Reference Antibody (mibavademab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LEPR / CD295 Reference Antibody (mibavademab)synonym : null,productDescription : Anti-LEPR /...
Post Categories Uncategorized Post dateJuly 10, 2024Post last updated dateUpdated July 10, 2024 Anti-LAP Reference Antibody (Brigham and Womens anti-LAP) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LAP Reference Antibody (Brigham and Womens anti-LAP)synonym : null,productDescription : Anti-LAP...
Post Categories Uncategorized Post dateJuly 10, 2024Post last updated dateUpdated July 10, 2024 Anti-LAG3 / CD223 Reference Antibody (relatlimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LAG3 / CD223 Reference Antibody (relatlimab)synonym : null,productDescription : Anti-LAG3 /...
Post Categories Uncategorized Post dateJuly 10, 2024Post last updated dateUpdated July 10, 2024 Anti-KIR2DL1 / CD158a Reference Antibody (Innate patent anti-KIR2DL) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-KIR2DL1 / CD158a Reference Antibody (Innate patent anti-KIR2DL)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 9, 2024Post last updated dateUpdated July 9, 2024 Anti-IL-9 Reference Antibody (enokizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-IL-9 Reference Antibody (enokizumab)synonym : null,productDescription : Anti-IL-9 Reference Antibody (enokizumab)(CHA282)...
Post Categories Uncategorized Post dateJuly 9, 2024Post last updated dateUpdated July 9, 2024 Anti-CXCL8 / IL-8 Reference Antibody (HuMax-IL8) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CXCL8 / IL-8 Reference Antibody (HuMax-IL8)synonym : null,productDescription : Anti-CXCL8 /...
Post Categories Uncategorized Post dateJuly 9, 2024Post last updated dateUpdated July 9, 2024 Anti-CD57 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD57 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 38endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJuly 8, 2024Post last updated dateUpdated July 8, 2024 Anti-IL-7Ra / CD127 Reference Antibody (lusvertikimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-7Ra / CD127 Reference Antibody (lusvertikimab)synonym : null,productDescription : Anti-IL-7Ra /...
Post Categories Uncategorized Post dateJuly 8, 2024Post last updated dateUpdated July 8, 2024 Anti-IL-5Ra/ CD125 Reference Antibody (benralizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-5Ra/ CD125 Reference Antibody (benralizumab)synonym : null,productDescription : Anti-IL-5Ra/ CD125 Reference...
Post Categories Uncategorized Post dateJuly 8, 2024Post last updated dateUpdated July 8, 2024 Anti-IL-5 Reference Antibody (mepolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-IL-5 Reference Antibody (mepolizumab)synonym : null,productDescription : Anti-IL-5 Reference Antibody (mepolizumab)(CHA277)...
Post Categories Uncategorized Post dateJuly 7, 2024Post last updated dateUpdated July 7, 2024 Anti-IL-4Ra / CD124 Reference Antibody (dupilumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-4Ra / CD124 Reference Antibody (dupilumab)synonym : null,productDescription : Anti-IL-4Ra /...
Post Categories Uncategorized Post dateJuly 7, 2024Post last updated dateUpdated July 7, 2024 Anti-IL-4 Reference Antibody (pascolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-IL-4 Reference Antibody (pascolizumab)synonym : null,productDescription : Anti-IL-4 Reference Antibody (pascolizumab)(CHA275)...
Post Categories Uncategorized Post dateJuly 7, 2024Post last updated dateUpdated July 7, 2024 Anti-IL-33 Reference Antibody (etokimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-33 Reference Antibody (etokimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (etokimab)(CHA274)...
Post Categories Uncategorized Post dateJuly 6, 2024Post last updated dateUpdated July 6, 2024 Anti-IL-31Ra Reference Antibody (nemolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-31Ra Reference Antibody (nemolizumab)synonym : null,productDescription : Anti-IL-31Ra Reference Antibody (nemolizumab)(CHA273)...
Post Categories Uncategorized Post dateJuly 6, 2024Post last updated dateUpdated July 6, 2024 Anti-IL-2Ra / CD25 Reference Antibody (daclizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-2Ra / CD25 Reference Antibody (daclizumab)synonym : null,productDescription : Anti-IL-2Ra /...
Post Categories Uncategorized Post dateJuly 6, 2024Post last updated dateUpdated July 6, 2024 Anti-IL-2Rb / CD122 Reference Antibody (Singapore ASTR patent anti-IL-2R beta / IL-2R gamma\t) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-2Rb / CD122 Reference Antibody (Singapore ASTR patent anti-IL-2R beta /...
Post Categories Uncategorized Post dateJuly 5, 2024Post last updated dateUpdated July 5, 2024 Anti-IL-23a Reference Antibody (tildrakizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-23a Reference Antibody (tildrakizumab)synonym : null,productDescription : Anti-IL-23a Reference Antibody (tildrakizumab)(CHA270)...
Post Categories Uncategorized Post dateJuly 5, 2024Post last updated dateUpdated July 5, 2024 Anti-NCAM1 / CD56 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-NCAM1 / CD56 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 95endotoxin...
Post Categories Uncategorized Post dateJuly 5, 2024Post last updated dateUpdated July 5, 2024 Anti-IL-23 Reference Antibody (guselkumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-23 Reference Antibody (guselkumab)synonym : null,productDescription : Anti-IL-23 Reference Antibody (guselkumab)(CHA269)...
Post Categories Uncategorized Post dateJuly 4, 2024Post last updated dateUpdated July 4, 2024 Anti-IL-22 Reference Antibody (fezakinumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-IL-22 Reference Antibody (fezakinumab)synonym : null,productDescription : Anti-IL-22 Reference Antibody (fezakinumab)(CHA268)...
Post Categories Uncategorized Post dateJuly 4, 2024Post last updated dateUpdated July 4, 2024 Anti-IL-20Ra Reference Antibody (Cheng Kung U. patent anti-IL-20R1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-IL-20Ra Reference Antibody (Cheng Kung U. patent anti-IL-20R1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJuly 4, 2024Post last updated dateUpdated July 4, 2024 Anti-IL-20 Reference Antibody (fletikumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-20 Reference Antibody (fletikumab)synonym : null,productDescription : Anti-IL-20 Reference Antibody (fletikumab)(CHA266)...
Post Categories Uncategorized Post dateJuly 3, 2024Post last updated dateUpdated July 3, 2024 Anti-IL-1RL2 / IL-36R Reference Antibody (imsidolimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-1RL2 / IL-36R Reference Antibody (imsidolimab)synonym : null,productDescription : Anti-IL-1RL2 /...
Post Categories Uncategorized Post dateJuly 3, 2024Post last updated dateUpdated July 3, 2024 Anti-IL-1RL2 / IL-36R Reference Antibody (spesolimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-IL-1RL2 / IL-36R Reference Antibody (spesolimab)synonym : null,productDescription : Anti-IL-1RL2 /...
Post Categories Uncategorized Post dateJuly 3, 2024Post last updated dateUpdated July 3, 2024 Anti-IL-1R1 / CD121a Reference Antibody (AMG 108) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-1R1 / CD121a Reference Antibody (AMG 108)synonym : null,productDescription : Anti-IL-1R1...
Post Categories Uncategorized Post dateJuly 2, 2024Post last updated dateUpdated July 2, 2024 Anti-IL-17c Reference Antibody (MOR106) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-IL-17c Reference Antibody (MOR106)synonym : null,productDescription : Anti-IL-17c Reference Antibody (MOR106)(CHA261)...
Post Categories Uncategorized Post dateJuly 2, 2024Post last updated dateUpdated July 2, 2024 Anti-IL-13Ra2 / CD213a2 Reference Antibody (Wake Forest U. patent anti-IL-13RA2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-13Ra2 / CD213a2 Reference Antibody (Wake Forest U. patent anti-IL-13RA2)synonym :...
Post Categories Uncategorized Post dateJuly 2, 2024Post last updated dateUpdated July 2, 2024 Anti-IL-13 Reference Antibody (anrukinzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-13 Reference Antibody (anrukinzumab)synonym : null,productDescription : Anti-IL-13 Reference Antibody (anrukinzumab)(CHA259)...
Post Categories Uncategorized Post dateJuly 1, 2024Post last updated dateUpdated July 1, 2024 Anti-CD45RO Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD45RO Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJuly 1, 2024Post last updated dateUpdated July 1, 2024 Anti-IGF1R / CD221 Reference Antibody (teprotumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-IGF1R / CD221 Reference Antibody (teprotumumab)synonym : null,productDescription : Anti-IGF1R /...
Post Categories Uncategorized Post dateJuly 1, 2024Post last updated dateUpdated July 1, 2024 Anti-IGF-1 Reference Antibody (xentuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IGF-1 Reference Antibody (xentuzumab)synonym : null,productDescription : Anti-IGF1 Reference Antibody (xentuzumab)(CHA256)...
Post Categories Uncategorized Post dateJune 30, 2024Post last updated dateUpdated June 30, 2024 Anti-IFNa1 Reference Antibody (sifalimumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IFNa1 Reference Antibody (sifalimumab)synonym : null,productDescription : Anti-IFNa1 Reference Antibody (sifalimumab)(CHA255)...
Post Categories Uncategorized Post dateJune 30, 2024Post last updated dateUpdated June 30, 2024 Anti-IFNa1 Reference Antibody (rontalizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-IFNa1 Reference Antibody (rontalizumab)synonym : null,productDescription : Anti-IFNa1 Reference Antibody (rontalizumab)(CHA254)...
Post Categories Uncategorized Post dateJune 30, 2024Post last updated dateUpdated June 30, 2024 Anti-IDO2 Reference Antibody (LIMR patent anti-IDO2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IDO2 Reference Antibody (LIMR patent anti-IDO2)synonym : null,productDescription : Anti-IDO2 Reference...
Post Categories Uncategorized Post dateJune 29, 2024Post last updated dateUpdated June 29, 2024 Anti-ICOS / CD278 Reference Antibody (feladilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ICOS / CD278 Reference Antibody (feladilimab)synonym : null,productDescription : Anti-ICOS /...
Post Categories Uncategorized Post dateJune 29, 2024Post last updated dateUpdated June 29, 2024 Anti-ICOS / CD278 Reference Antibody (vopratelimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ICOS / CD278 Reference Antibody (vopratelimab)synonym : null,productDescription : Anti-ICOS /...
Post Categories Uncategorized Post dateJune 29, 2024Post last updated dateUpdated June 29, 2024 Anti-HGFR / c-Met Reference Antibody (emibetuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-HGFR / c-Met Reference Antibody (emibetuzumab)synonym : null,productDescription : Anti-HGFR /...
Post Categories Uncategorized Post dateJune 28, 2024Post last updated dateUpdated June 28, 2024 Anti-HGF / SF Reference Antibody (rilotumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-HGF / SF Reference Antibody (rilotumumab)synonym : null,productDescription : Anti-HGF /...
Post Categories Uncategorized Post dateJune 28, 2024Post last updated dateUpdated June 28, 2024 Anti-HGF / SF Reference Antibody (ficlatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-HGF / SF Reference Antibody (ficlatuzumab)synonym : null,productDescription : Anti-HGF /...
Post Categories Uncategorized Post dateJune 28, 2024Post last updated dateUpdated June 28, 2024 Anti-CD45R Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD45R Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-CD31 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-CD31 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 83 kDaendotoxin :...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-ERBB3 / HER3 Reference Antibody (seribantumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-ERBB3 / HER3 Reference Antibody (seribantumab)synonym : null,productDescription : Anti-ERBB3 /...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-ERBB3 / HER3 Reference Antibody (patritumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ERBB3 / HER3 Reference Antibody (patritumab)synonym : null,productDescription : Anti-ERBB3 /...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-HBEGF Reference Antibody (U3-1565) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-HBEGF Reference Antibody (U3-1565)synonym : null,productDescription : Anti-HBEGF Reference Antibody (U3-1565)(CHA244)...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-HBEGF Reference Antibody (KHK2866) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-HBEGF Reference Antibody (KHK2866)synonym : null,productDescription : Anti-HBEGF Reference Antibody (KHK2866)(CHA243)...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-Haptoglobin Reference Antibody (KHK patent anti-Haptoglobin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Haptoglobin Reference Antibody (KHK patent anti-Haptoglobin)synonym : null,productDescription : Anti-Haptoglobin Reference...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-GREM1 / Gremlin Reference Antibody (UCB patent anti-Gremlin-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GREM1 / Gremlin Reference Antibody (UCB patent anti-Gremlin-1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-GPRC5D Reference Antibody (talquetamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-GPRC5D Reference Antibody (talquetamab)synonym : null,productDescription : Anti-GPRC5D Reference Antibody (talquetamab)(CHA238)...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-GPR49 / LGR5 Reference Antibody (petosemtamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-GPR49 / LGR5 Reference Antibody (petosemtamab)synonym : null,productDescription : Anti-GPR49 /...
Post Categories Uncategorized Post dateJune 27, 2024Post last updated dateUpdated June 27, 2024 Anti-GPR49 / LGR5 Reference Antibody (BNC101) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-GPR49 / LGR5 Reference Antibody (BNC101)synonym : null,productDescription : Anti-GPR49 /...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-GPNMB Reference Antibody (glembatumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPNMB Reference Antibody (glembatumumab)synonym : null,productDescription : Anti-GPNMB Reference Antibody (glembatumumab)(CHA235)...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-PTPRC / CD45Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-PTPRC / CD45Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin :...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-GPA33 Reference Antibody (KRN330) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPA33 Reference Antibody (KRN330)synonym : null,productDescription : Anti-GPA33 Reference Antibody (KRN330)(CHA234)...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-CSF2Ra / GM-CSFRa / CD116 Reference Antibody (mavrilimumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CSF2Ra / GM-CSFRa / CD116 Reference Antibody (mavrilimumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-TNFRSF18 / GITR / CD357 Reference Antibody (ragifilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF18 / GITR / CD357 Reference Antibody (ragifilimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-GIPR Reference Antibody (Amgen patent anti-GIPR) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GIPR Reference Antibody (Amgen patent anti-GIPR)synonym : null,productDescription : Anti-GIPR Reference...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-CSF3R / G-CSFR Reference Antibody (CSL patent anti-G-CSFR) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CSF3R / G-CSFR Reference Antibody (CSL patent anti-G-CSFR)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-GCGR Reference Antibody (volagidemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GCGR Reference Antibody (volagidemab)synonym : null,productDescription : Anti-GCGR Reference Antibody (volagidemab)(CHA227)...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-GCGR Reference Antibody (crotedumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GCGR Reference Antibody (crotedumab)synonym : null,productDescription : Anti-GCGR Reference Antibody (crotedumab)(CHA226)...
Post Categories Uncategorized Post dateJune 26, 2024Post last updated dateUpdated June 26, 2024 Anti-FZD7 Reference Antibody (U.Toronto patent anti-FZD7) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FZD7 Reference Antibody (U.Toronto patent anti-FZD7)synonym : null,productDescription : Anti-FZD7 Reference...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FLT3 / CD135 Reference Antibody (IMC-EB10) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-FLT3 / CD135 Reference Antibody (IMC-EB10)synonym : null,productDescription : Anti-FLT3 /...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-Fibronectin Reference Antibody (L19-TNF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Fibronectin Reference Antibody (L19-TNF)synonym : null,productDescription : Anti-Fibronectin Reference Antibody (L19-TNF)(CHA219)...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-CD44 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD44 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 82endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FGFR4 / CD334 Reference Antibody (U3-1784) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FGFR4 / CD334 Reference Antibody (U3-1784)synonym : null,productDescription : Anti-FGFR4 /...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FGFR3 / CD333 Reference Antibody (vofatamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FGFR3 / CD333 Reference Antibody (vofatamab)synonym : null,productDescription : Anti-FGFR3 /...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FGFR3 / CD333 Reference Antibody (LY3076226) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-FGFR3 / CD333 Reference Antibody (LY3076226)synonym : null,productDescription : Anti-FGFR3 /...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FGF2 Reference Antibody (HuGAL-F2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FGF2 Reference Antibody (HuGAL-F2)synonym : null,productDescription : Anti-FGF2 Reference Antibody (HuGAL-F2)(CHA215)...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-FGF19 Reference Antibody (1A6) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FGF19 Reference Antibody (1A6)synonym : null,productDescription : Anti-FGF19 Reference Antibody (1A6)(CHA214)...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-SLC40A1 Reference Antibody (Amgen patent anti-Ferroportin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-SLC40A1 Reference Antibody (Amgen patent anti-Ferroportin)synonym : null,productDescription : Anti-SLC40A1 Reference...
Post Categories Uncategorized Post dateJune 25, 2024Post last updated dateUpdated June 25, 2024 Anti-SLC40A1 Reference Antibody (LY2928057) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-SLC40A1 Reference Antibody (LY2928057)synonym : null,productDescription : Anti-SLC40A1 Reference Antibody (LY2928057)(CHA212)...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-FAP Reference Antibody (sibrotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-FAP Reference Antibody (sibrotuzumab)synonym : null,productDescription : Anti-FAP Reference Antibody (sibrotuzumab)(CHA211)...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-EPOR Reference Antibody (Abbott patent anti-EPO Receptor) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-EPOR Reference Antibody (Abbott patent anti-EPO Receptor)synonym : null,productDescription : Anti-EPOR...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-EphB4 Reference Antibody (VasGene patent anti-EphB4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-EphB4 Reference Antibody (VasGene patent anti-EphB4)synonym : null,productDescription : Anti-EphB4 Reference...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-CD43 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD43 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-EphB4 Reference Antibody (Morphosys patent anti-EphB4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-EphB4 Reference Antibody (Morphosys patent anti-EphB4)synonym : null,productDescription : Anti-EphB4 Reference...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-EphB2 Reference Antibody (Genentech patent anti-EphB2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-EphB2 Reference Antibody (Genentech patent anti-EphB2)synonym : null,productDescription : Anti-EphB2 Reference...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-EpCAM / TROP1 / CD326 Reference Antibody (citatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-EpCAM / TROP1 / CD326 Reference Antibody (citatuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-TNFRSF21 / DR6 / CD358 Reference Antibody (Abbvie patent anti-TNFRSF21) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF21 / DR6 / CD358 Reference Antibody (Abbvie patent anti-TNFRSF21)synonym :...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-DLL4 Reference Antibody (navicixizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-DLL4 Reference Antibody (navicixizumab)synonym : null,productDescription : Anti-DLL4 Reference Antibody (navicixizumab)(CHA199)...
Post Categories Uncategorized Post dateJune 24, 2024Post last updated dateUpdated June 24, 2024 Anti-DLL4 Reference Antibody (demcizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-DLL4 Reference Antibody (demcizumab)synonym : null,productDescription : Anti-DLL4 Reference Antibody (demcizumab)(CHA198)...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-DKK1 Reference Antibody (BHQ-880) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-DKK1 Reference Antibody (BHQ-880)synonym : null,productDescription : Anti-DKK1 Reference Antibody (BHQ-880)(CHA197)...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CLEC7A Reference Antibody (Baylor patent anti-Dectin-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLEC7A Reference Antibody (Baylor patent anti-Dectin-1)synonym : null,productDescription : Anti-CLEC7A Reference...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-DC-SIGN / CD209 Reference Antibody (INSERM patent anti-DC-SIGN) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-DC-SIGN / CD209 Reference Antibody (INSERM patent anti-DC-SIGN)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CXCR5 / CD185 Reference Antibody (SAR113244) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CXCR5 / CD185 Reference Antibody (SAR113244)synonym : null,productDescription : Anti-CXCR5 /...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CD38 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD38 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CXCL9 Reference Antibody (Novimmune patent anti-CXCL9) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CXCL9 Reference Antibody (Novimmune patent anti-CXCL9)synonym : null,productDescription : Anti-CXCL9 Reference...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CXCL10 / IP-10 Reference Antibody (eldelumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CXCL10 / IP-10 Reference Antibody (eldelumab)synonym : null,productDescription : Anti-CXCL10 /...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CXADR Reference Antibody (Med. Bio. Labs patent anti-CXADR) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CXADR Reference Antibody (Med. Bio. Labs patent anti-CXADR)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CSF1R / M-CSFR / CD115 Reference Antibody (cabiralizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (cabiralizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 23, 2024Post last updated dateUpdated June 23, 2024 Anti-CRTAM / CD355 Reference Antibody (Oxford Bio patent anti-CRTAM) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CRTAM / CD355 Reference Antibody (Oxford Bio patent anti-CRTAM)synonym : null,productDescription...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CLEC14A Reference Antibody (Scripps Korea patent anti-CLEC14A) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLEC14A Reference Antibody (Scripps Korea patent anti-CLEC14A)synonym : null,productDescription : Anti-CLEC14A...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CLEC12A / CD371 Reference Antibody (tepoditamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLEC12A / CD371 Reference Antibody (tepoditamab)synonym : null,productDescription : Anti-CLEC12A /...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CLDN6 Reference Antibody (IMAB027) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-CLDN6 Reference Antibody (IMAB027)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IMAB027)(CHA182)...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CLDN18.2 Reference Antibody (zolbetuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN18.2 Reference Antibody (zolbetuximab)synonym : null,productDescription : Anti-CLDN18.2 Reference Antibody (zolbetuximab)(CHA181)...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-DCBLD2 / ESDN Reference Antibody (FA19-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-DCBLD2 / ESDN Reference Antibody (FA19-1)synonym : null,productDescription : Anti-DCBLD2 /...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CD35 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD35 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 224endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CCL20 Reference Antibody (GSK3050002) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CCL20 Reference Antibody (GSK3050002)synonym : null,productDescription : Anti-CCL20 Reference Antibody (GSK3050002)(CHA179)...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CHI3L1 Reference Antibody (Brown U. patent anti-CHI3L1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CHI3L1 Reference Antibody (Brown U. patent anti-CHI3L1)synonym : null,productDescription : Anti-CHI3L1...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CEACAM6 / CD66c Reference Antibody (NEO-201) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CEACAM6 / CD66c Reference Antibody (NEO-201)synonym : null,productDescription : Anti-CEACAM6 /...
Post Categories Uncategorized Post dateJune 22, 2024Post last updated dateUpdated June 22, 2024 Anti-CEACAM1 / CD66a Reference Antibody (CM-24) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-CEACAM1 / CD66a Reference Antibody (CM-24)synonym : null,productDescription : Anti-CEACAM1 /...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CDCP1 / CD318 Reference Antibody (U.California patent anti-CDCP1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CDCP1 / CD318 Reference Antibody (U.California patent anti-CDCP1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD79b Reference Antibody (polatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CD79b Reference Antibody (polatuzumab)synonym : null,productDescription : Anti-CD79b Reference Antibody (polatuzumab)(CHA171)...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD69 Reference Antibody (Genefrontier patent anti-CD69) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD69 Reference Antibody (Genefrontier patent anti-CD69)synonym : null,productDescription : Anti-CD69 Reference...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab)synonym : null,productDescription : Anti-NCAM1 /...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD52 Reference Antibody (alemtuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD52 Reference Antibody (alemtuzumab)synonym : null,productDescription : Anti-CD52 Reference Antibody (alemtuzumab)(CHA166)...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD34 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD34 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 41endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD47 Reference Antibody (CC-90002) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-CD47 Reference Antibody (CC-90002)synonym : null,productDescription : Anti-CD47 Reference Antibody (CC-90002)(CHA165)...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD47 Reference Antibody (magrolimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD47 Reference Antibody (magrolimab)synonym : null,productDescription : Anti-CD47 Reference Antibody (magrolimab)(CHA164)...
Post Categories Uncategorized Post dateJune 21, 2024Post last updated dateUpdated June 21, 2024 Anti-CD46 Reference Antibody (FOR46) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD46 Reference Antibody (FOR46)synonym : null,productDescription : Anti-CD46 Reference Antibody (FOR46)(CHA163)...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (dacetuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (dacetuzumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (sotigalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (sotigalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (bleselumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (bleselumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-ENTPD1 / CD39 Reference Antibody (TTX-030) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ENTPD1 / CD39 Reference Antibody (TTX-030)synonym : null,productDescription : Anti-ENTPD1 /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-FcgR2a / CD32a Reference Antibody (VIB9600) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FcgR2a / CD32a Reference Antibody (VIB9600)synonym : null,productDescription : Anti-FcgR2a /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-IL-2Ra / CD25 Reference Antibody (basiliximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-IL-2Ra / CD25 Reference Antibody (basiliximab)synonym : null,productDescription : Anti-IL-2Ra /...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-TNFRSF8 / CD30 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-TNFRSF8 / CD30 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 64endotoxin...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-OX2R / CD200R1 Reference Antibody (Janssen patent anti-CD200R1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-OX2R / CD200R1 Reference Antibody (Janssen patent anti-CD200R1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 20, 2024Post last updated dateUpdated June 20, 2024 Anti-CD200 Reference Antibody (samalizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD200 Reference Antibody (samalizumab)synonym : null,productDescription : Anti-CD200 Reference Antibody (samalizumab)(CHA148)...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-PROM1 / CD133 Reference Antibody (Forerunner patent anti-Prominin-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PROM1 / CD133 Reference Antibody (Forerunner patent anti-Prominin-1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab)synonym : null,productDescription : Anti-IL-3Ra /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-IL-3Ra / CD123 Reference Antibody (SNG-CD123A) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-IL-3Ra / CD123 Reference Antibody (SNG-CD123A)synonym : null,productDescription : Anti-IL-3Ra /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-SCFR / c-Kit / CD117 Reference Antibody (LOP628) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-SCFR / c-Kit / CD117 Reference Antibody (LOP628)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-CCR7 / CD197 Reference Antibody (R707) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CCR7 / CD197 Reference Antibody (R707)synonym : null,productDescription : Anti-CCR7 /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-CCR4 / CD194 Reference Antibody (mogamulizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-CCR4 / CD194 Reference Antibody (mogamulizumab)synonym : null,productDescription : Anti-CCR4 /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-CCR2 / CD192 Reference Antibody (plozalizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CCR2 / CD192 Reference Antibody (plozalizumab)synonym : null,productDescription : Anti-CCR2 /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-CCL5 / RANTES Reference Antibody (VLST-002) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CCL5 / RANTES Reference Antibody (VLST-002)synonym : null,productDescription : Anti-CCL5 /...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-FceR2 / CD23 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-FceR2 / CD23 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin...
Post Categories Uncategorized Post dateJune 19, 2024Post last updated dateUpdated June 19, 2024 Anti-CTSS / Cathepsin S Reference Antibody (Fsn0503h) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CTSS / Cathepsin S Reference Antibody (Fsn0503h)synonym : null,productDescription : Anti-CTSS...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-CA9 / CAIX Reference Antibody (girentuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CA9 / CAIX Reference Antibody (girentuximab)synonym : productDescription : Anti-CA9 /...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-CDH6 / K-Cadherin Reference Antibody (HKT288) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CDH6 / K-Cadherin Reference Antibody (HKT288)synonym : null,productDescription : Anti-CDH6 /...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-Complement C5aR1 Reference Antibody (G2_anti-C5aR) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Complement C5aR1 Reference Antibody (G2_anti-C5aR)synonym : null,productDescription : Anti-Complement C5aR1 Reference...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-C1s Reference Antibody (sutimlimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-C1s Reference Antibody (sutimlimab)synonym : null,productDescription : Anti-C1s Reference Antibody (sutimlimab)(CHA129)...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-BST2 / CD317 Reference Antibody (XmAb 5592) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-BST2 / CD317 Reference Antibody (XmAb 5592)synonym : null,productDescription : Anti-BST2...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-Klotho Beta Reference Antibody (NGM313) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Klotho Beta Reference Antibody (NGM313)synonym : null,productDescription : Anti-Klotho Beta Reference...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-Klotho Beta Reference Antibody (RG7992) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-Klotho Beta Reference Antibody (RG7992)synonym : null,productDescription : Anti-Klotho Beta Reference...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-Bcl-2 Reference Antibody (U.Toronto patent anti-Bax) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-Bcl-2 Reference Antibody (U.Toronto patent anti-Bax)synonym : null,productDescription : Anti-Bcl-2 Reference...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-TNFSF13B / BAFF / CD257 Reference Antibody (belimumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF13B / BAFF / CD257 Reference Antibody (belimumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 18, 2024Post last updated dateUpdated June 18, 2024 Anti-CD21 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time39 sec read Product Name : Anti-CD21 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 113endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-B7-H6 / NCR3LG1 Reference Antibody (Dartmouth patent anti-B7-H6) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H6 / NCR3LG1 Reference Antibody (Dartmouth patent anti-B7-H6)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-B7-H5 / VISTA Reference Antibody (onvatilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H5 / VISTA Reference Antibody (onvatilimab)synonym : null,productDescription : Anti-B7-H5 /...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-B7-H3 / CD276 Reference Antibody (enoblituzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H3 / CD276 Reference Antibody (enoblituzumab)synonym : null,productDescription : Anti-B7-H3 /...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-TNFSF13 / APRIL / CD256 Reference Antibody (BION-1301) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF13 / APRIL / CD256 Reference Antibody (BION-1301)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-Serum Amyloid P / SAP Reference Antibody (dezamizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Serum Amyloid P / SAP Reference Antibody (dezamizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-ANGPTL3 Reference Antibody (evinacumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ANGPTL3 Reference Antibody (evinacumab)synonym : null,productDescription : Anti-ANGPTL3 Reference Antibody (evinacumab)(CHA116)...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-ANGPT2 Reference Antibody (nesvacumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ANGPT2 Reference Antibody (nesvacumab)synonym : null,productDescription : Anti-ANGPT2 Reference Antibody (nesvacumab)(CHA115)...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-Alpha-synuclein Reference Antibody (prasinezumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Alpha-synuclein Reference Antibody (prasinezumab)synonym : null,productDescription : Anti-Alpha-synuclein Reference Antibody (prasinezumab)(CHA113)...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-Alpha-synuclein Reference Antibody (cinpanemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Alpha-synuclein Reference Antibody (cinpanemab)synonym : null,productDescription : Anti-Alpha-synuclein Reference Antibody (cinpanemab)(CHA112)...
Post Categories Uncategorized Post dateJune 17, 2024Post last updated dateUpdated June 17, 2024 Anti-ACVRL1 / ALK-1 Reference Antibody (ascrinvacumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-ACVRL1 / ALK-1 Reference Antibody (ascrinvacumab)synonym : null,productDescription : Anti-ACVRL1 /...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-FcgR3a / CD16a Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-FcgR3a / CD16a Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-CD19 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD19 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 61 kDaendotoxin :...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-ALCAM / CD166 Reference Antibody (AT002) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ALCAM / CD166 Reference Antibody (AT002)synonym : null,productDescription : Anti-ALCAM /...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-ALCAM / CD166 Reference Antibody (praluzatamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ALCAM / CD166 Reference Antibody (praluzatamab)synonym : null,productDescription : Anti-ALCAM /...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-ACVR2B Reference Antibody (bimagrumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ACVR2B Reference Antibody (bimagrumab)synonym : null,productDescription : Anti-ACVR2B Reference Antibody (bimagrumab)(CHA108)...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-ACVR2A Reference Antibody (Ab-14E1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ACVR2A Reference Antibody (Ab-14E1)synonym : null,productDescription : Anti-ACVR2A Reference Antibody (Ab-14E1)(CHA106)...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-ACVR1 / ALK-2 Reference Antibody (DS-6016a) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ACVR1 / ALK-2 Reference Antibody (DS-6016a)synonym : null,productDescription : Anti-ACVR1 /...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-TNFSF9 / 4-1BBL Reference Antibody (Abbvie patent anti-TNFSF9) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF9 / 4-1BBL Reference Antibody (Abbvie patent anti-TNFSF9)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (urelumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (urelumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 16, 2024Post last updated dateUpdated June 16, 2024 Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (utomilumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (utomilumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-VEGFR2 / KDR / CD309 Reference Antibody (ramucirumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (ramucirumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-VEGFA Reference Antibody (bevacizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-VEGFA Reference Antibody (bevacizumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (bevacizumab)(CHA099)...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-CD14 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD14 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-TNFSF2 / TNFa Reference Antibody (infliximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (infliximab)synonym : null,productDescription : Anti-TNFSF2 /...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-TNFSF2 / TNFa Reference Antibody (adalimumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (adalimumab)synonym : null,productDescription : Anti-TNFSF2 /...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-TIGIT Reference Antibody (tiragolumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-TIGIT Reference Antibody (tiragolumab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (tiragolumab)(CHA096)...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-SLAMF7 / CS1 Reference Antibody (elotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-SLAMF7 / CS1 Reference Antibody (elotuzumab)synonym : null,productDescription : Anti-SLAMF7 /...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-Siglec-8 Reference Antibody (lirentelimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-Siglec-8 Reference Antibody (lirentelimab)synonym : null,productDescription : Anti-Siglec-8 Reference Antibody (lirentelimab)(CHA094)...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-Siglec-15 / CD33L3 Reference Antibody (NC318) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (NC318)synonym : null,productDescription : Anti-Siglec-15 /...
Post Categories Uncategorized Post dateJune 15, 2024Post last updated dateUpdated June 15, 2024 Anti-ROR1 Reference Antibody (zilovertamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-ROR1 Reference Antibody (zilovertamab)synonym : null,productDescription : Anti-ROR1 Reference Antibody (zilovertamab)(CHA092)...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-RGMA Reference Antibody (elezanumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-RGMA Reference Antibody (elezanumab)synonym : null,productDescription : Anti-RGMA Reference Antibody (elezanumab)(CHA091)...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-FOLH1 / PSMA Reference Antibody (rosopatamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab)synonym : null,productDescription : Anti-FOLH1 /...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-PSGL1 / CD162 Reference Antibody (neihulizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PSGL1 / CD162 Reference Antibody (neihulizumab)synonym : productDescription : Anti-PSGL1 /...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-CD13 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD13 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 110endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-P-Selectin / CD62p Reference Antibody (crizanlizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-P-Selectin / CD62p Reference Antibody (crizanlizumab)synonym : null,productDescription : Anti-P-Selectin /...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-P-Selectin / CD62p Reference Antibody (inclacumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-P-Selectin / CD62p Reference Antibody (inclacumab)synonym : null,productDescription : Anti-P-Selectin /...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-PMEL Reference Antibody (Novartis patent anti-PMEL17) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PMEL Reference Antibody (Novartis patent anti-PMEL17)synonym : null,productDescription : Anti-PMEL Reference...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-PMEL Reference Antibody (Genentech anti-PMEL17) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PMEL Reference Antibody (Genentech anti-PMEL17)synonym : null,productDescription : Anti-PMEL Reference Antibody...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (durvalumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (durvalumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 14, 2024Post last updated dateUpdated June 14, 2024 Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (atezolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (atezolizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (MDX-1105) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (MDX-1105)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (avelumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (avelumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-PDGFB Reference Antibody (MOR-8457) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-PDGFB Reference Antibody (MOR-8457)synonym : null,productDescription : Anti-PDGFB Reference Antibody (MOR-8457)(CHA080)...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nivolumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nivolumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-Neprilysin / CD10 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Neprilysin / CD10 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 86endotoxin...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-PDCD1 / PD-1 / CD279 Reference Antibody (pembrolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (pembrolizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-PDCD1 / PD-1 / CD279 Reference Antibody (camrelizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (camrelizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-PDCD1 / PD-1 / CD279 Reference Antibody (spartalizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time12 sec read Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (spartalizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-NT5E / CD73 Reference Antibody (oleclumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-NT5E / CD73 Reference Antibody (oleclumab)synonym : null,productDescription : Anti-NT5E /...
Post Categories Uncategorized Post dateJune 13, 2024Post last updated dateUpdated June 13, 2024 Anti-NKG2D / CD314 Reference Antibody (tesnatilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-NKG2D / CD314 Reference Antibody (tesnatilimab)synonym : null,productDescription : Anti-NKG2D /...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-Nectin-4 Reference Antibody (enfortumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Nectin-4 Reference Antibody (enfortumab)synonym : null,productDescription : Anti-Nectin-4 Reference Antibody (enfortumab)(CHA073)...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-CSF1 / M-CSF Reference Antibody (lacnotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-CSF1 / M-CSF Reference Antibody (lacnotuzumab)synonym : null,productDescription : Anti-CSF1 /...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-LILRB4 / ILT3 / CD85k Reference Antibody (U.Texas patent anti-LILRB4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-LILRB4 / ILT3 / CD85k Reference Antibody (U.Texas patent anti-LILRB4)synonym :...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-LILRB4 / ILT3 / CD85k Reference Antibody (Merck patent anti-ILT3 complex) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-LILRB4 / ILT3 / CD85k Reference Antibody (Merck patent anti-ILT3 complex)synonym...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-LIF Reference Antibody (MSC-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LIF Reference Antibody (MSC-1)synonym : null,productDescription : Anti-LIF Reference Antibody (MSC-1)(CHA069)...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-CD8 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD8 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 26endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-KIR3DL2 / CD158k Reference Antibody (lacutamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-KIR3DL2 / CD158k Reference Antibody (lacutamab)synonym : null,productDescription : Anti-KIR3DL2 /...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-KIR Reference Antibody (lirilumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-KIR Reference Antibody (lirilumab)synonym : null,productDescription : Anti-KIR Reference Antibody (lirilumab)(CHA067)...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-IL-6Ra / CD126 Reference Antibody (tocilizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-6Ra / CD126 Reference Antibody (tocilizumab)synonym : null,productDescription : Anti-IL-6Ra /...
Post Categories Uncategorized Post dateJune 12, 2024Post last updated dateUpdated June 12, 2024 Anti-IL-6Ra / CD126 Reference Antibody (sarilumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-6Ra / CD126 Reference Antibody (sarilumab)synonym : null,productDescription : Anti-IL-6Ra /...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-6Ra / CD126 Reference Antibody (vobarilizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-IL-6Ra / CD126 Reference Antibody (vobarilizumab)synonym : null,productDescription : Anti-IL-6Ra /...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-6 / IFNb2 Reference Antibody (clazakizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-6 / IFNb2 Reference Antibody (clazakizumab)synonym : null,productDescription : Anti-IL-6 /...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-21 Reference Antibody (Lilly patent anti-IL-21) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-21 Reference Antibody (Lilly patent anti-IL-21)synonym : null,productDescription : Anti-IL-21 Reference...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-1RAP / IL-1R3 Reference Antibody (nidanilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-1RAP / IL-1R3 Reference Antibody (nidanilimab)synonym : null,productDescription : Anti-IL-1RAP /...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-18 Reference Antibody (GSK 1070806) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-IL-18 Reference Antibody (GSK 1070806)synonym : null,productDescription : Anti-IL-18 Reference Antibody...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-17Ra / CD217 Reference Antibody (brodalumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-17Ra / CD217 Reference Antibody (brodalumab)synonym : null,productDescription : Anti-IL-17Ra /...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-CD7 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD7 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 25endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-IL-15 Reference Antibody (ordesekimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-15 Reference Antibody (ordesekimab)synonym : null,productDescription : Anti-IL-15 Reference Antibody (ordesekimab)(CHA055)...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (pertuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (pertuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 11, 2024Post last updated dateUpdated June 11, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (trastuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (trastuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (zanidatamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (zanidatamab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (disitamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (disitamab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-GPC3 / Glypican-3 Reference Antibody (codrituzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPC3 / Glypican-3 Reference Antibody (codrituzumab)synonym : null,productDescription : Anti-GPC3 /...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-FOLR1 / FRA Reference Antibody (mirvetuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FOLR1 / FRA Reference Antibody (mirvetuximab)synonym : null,productDescription : Anti-FOLR1 Reference...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-FOLR1 / FRA Reference Antibody (farletuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time10 sec read Product Name : Anti-FOLR1 / FRA Reference Antibody (farletuzumab)synonym : null,productDescription : Anti-FOLR1 Reference...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-FGFR2 / CD332 Reference Antibody (aprutumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FGFR2 / CD332 Reference Antibody (aprutumab)synonym : null,productDescription : Anti-FGFR2 /...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-FGFR2 / CD332 Reference Antibody (bemarituzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time11 sec read Product Name : Anti-FGFR2 / CD332 Reference Antibody (bemarituzumab)synonym : null,productDescription : Anti-FGFR2 /...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-CD5 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD5 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 55endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-FcRn (FCGRT & B2M) Reference Antibody (rozanolixizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FcRn (FCGRT & B2M) Reference Antibody (rozanolixizumab)synonym : null,productDescription : Anti-FcRn...
Post Categories Uncategorized Post dateJune 10, 2024Post last updated dateUpdated June 10, 2024 Anti-EphA2 Reference Antibody (Sanofi Aventis patent anti-EphA2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-EphA2 Reference Antibody (Sanofi Aventis patent anti-EphA2)synonym : null,productDescription : Anti-EphA2...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-EphA2 Reference Antibody (MEDI-547) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time10 sec read Product Name : Anti-EphA2 Reference Antibody (MEDI-547)synonym : null,productDescription : Anti-EphA2 Reference Antibody (MEDI-547)(CHA043)...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (cetuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (cetuximab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tigatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tigatuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (conatumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (conatumumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-DLL3 Reference Antibody (Dragonfly patent anti-DLL3) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-DLL3 Reference Antibody (Dragonfly patent anti-DLL3)synonym : null,productDescription : Anti-DLL3 Reference...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-DLL3 Reference Antibody (rovalpituzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-DLL3 Reference Antibody (rovalpituzumab)synonym : null,productDescription : Anti-DLL3 Reference Antibody (rovalpituzumab)(CHA037)...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-LY75 / CD205/DEC-205 Reference Antibody (CDX-1401) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LY75 / CD205/DEC-205 Reference Antibody (CDX-1401)synonym : null,productDescription : Anti-LY75 /...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-LY75 / CD205/DEC-205 Reference Antibody (MEN1309) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-LY75 / CD205/DEC-205 Reference Antibody (MEN1309)synonym : null,productDescription : Anti-LY75 /...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-CD4 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD4 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 51endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 9, 2024Post last updated dateUpdated June 9, 2024 Anti-CXCR4 / CD184 Reference Antibody (ulocuplumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CXCR4 / CD184 Reference Antibody (ulocuplumab)synonym : null,productDescription : Anti-CXCR4 /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CX3CL1 / Fractalkine Reference Antibody (quetmolimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-CX3CL1 / Fractalkine Reference Antibody (quetmolimab)synonym : null,productDescription : Anti-CX3CL1 /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CTLA-4 / CD152 Reference Antibody (ipilimumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CTLA-4 / CD152 Reference Antibody (ipilimumab)synonym : null,productDescription : Anti-CTLA-4 /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CCN2 / CTGF Reference Antibody (pamrevlumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CCN2 / CTGF Reference Antibody (pamrevlumab)synonym : null,productDescription : Anti-CCN2 /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-HGFR / c-Met Reference Antibody (onartuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-HGFR / c-Met Reference Antibody (onartuzumab)synonym : null,productDescription : Anti-HGFR /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-HGFR / c-Met Reference Antibody (telisotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-HGFR / c-Met Reference Antibody (telisotuzumab)synonym : null,productDescription : Anti-HGFR /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-HGFR / c-Met Reference Antibody (amivantamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-HGFR / c-Met Reference Antibody (amivantamab)synonym : null,productDescription : Anti-HGFR /...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-TNFSF7 / CD27L / CD70 Reference Antibody (vorsetuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF7 / CD27L / CD70 Reference Antibody (vorsetuzumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CD7 Reference Antibody (Persongen patent anti-CD7) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD7 Reference Antibody (Persongen patent anti-CD7)synonym : null,productDescription : Anti-CD7 Reference...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CD5 Reference Antibody (Magenta patent anti-CD5) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CD5 Reference Antibody (Magenta patent anti-CD5)synonym : null,productDescription : Anti-CD5 Reference...
Post Categories Uncategorized Post dateJune 8, 2024Post last updated dateUpdated June 8, 2024 Anti-CD2 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-CD2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 39endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-CD38 Reference Antibody (daratumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD38 Reference Antibody (daratumumab)synonym : null,productDescription : Anti-CD38 Reference Antibody (daratumumab)(CHA024)...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-TSPAN26 / CD37 Reference Antibody (naratuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-TSPAN26 / CD37 Reference Antibody (naratuximab)synonym : null,productDescription : Anti-TSPAN26 /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab)synonym : null,productDescription : Anti-Siglec-3 /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab)synonym : null,productDescription : Anti-TNFRSF8 /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-TNFRSF7 / CD27 Reference Antibody (varlilumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF7 / CD27 Reference Antibody (varlilumab)synonym : null,productDescription : Anti-TNFRSF7 /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-IGF1R / CD221 Reference Antibody (cixutumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IGF1R / CD221 Reference Antibody (cixutumumab)synonym : null,productDescription : Anti-IGF1R /...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-CD20 / MS4A1 Reference Antibody (obinutuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CD20 / MS4A1 Reference Antibody (obinutuzumab)synonym : null,productDescription : Anti-CD20 Reference...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-CD20 / MS4A1 Reference Antibody (rituximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CD20 / MS4A1 Reference Antibody (rituximab)synonym : null,productDescription : Anti-CD20 Reference...
Post Categories Uncategorized Post dateJune 7, 2024Post last updated dateUpdated June 7, 2024 Anti-CD19 Reference Antibody (tafasitamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD19 Reference Antibody (tafasitamab)synonym : null,productDescription : Anti-CD19 Reference Antibody (tafasitamab)(CHA014)...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-CD1a Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD1a Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-CD19 Reference Antibody (inebilizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD19 Reference Antibody (inebilizumab)synonym : null,productDescription : Anti-CD19 Reference Antibody (inebilizumab)(CHA013)...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-Spike S1 Reference Antibody (CR3022) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike S1 Reference Antibody (CR3022)synonym : null,productDescription : Anti-Spike S1 Reference...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-MERS Reference Antibody (D12) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-MERS Reference Antibody (D12)synonym : null,productDescription : Anti-MERS Reference Antibody (D12)(CHA004)...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-MERS Reference Antibody (3A1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-MERS Reference Antibody (3A1)synonym : null,productDescription : Anti-MERS Reference Antibody (3A1)(CHA003)...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-MERS Reference Antibody (2E6) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-MERS Reference Antibody (2E6)synonym : null,productDescription : Anti-MERS Reference Antibody (2E6)(CHA002)...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-SARS Reference Antibody (80R ) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-SARS Reference Antibody (80R )synonym : null,productDescription : Anti-SARS Reference Antibody...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-H3L Antibody (NAL_A185) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-H3L Antibody (NAL_A185)synonym : null,productDescription : Anti-H3L Antibody (AVA004) is expressed...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-E8L Antibody (NL_A151) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-E8L Antibody (NL_A151)synonym : null,productDescription : Anti-E8L Antibody (AVA003) is expressed...
Post Categories Uncategorized Post dateJune 6, 2024Post last updated dateUpdated June 6, 2024 Anti-Spike RBD (Omicron BA.2 / BA.2.75) Antibody (dAb-708) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Spike RBD (Omicron BA.2 / BA.2.75) Antibody (dAb-708)synonym : productDescription :...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike S1 (Omicron BA.2 / BA.2.75 / BA.4 / BA.5) Antibody (THS-699) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-Spike S1 (Omicron BA.2 / BA.2.75 / BA.4 / BA.5) Antibody...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Calretinin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Calretinin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 32endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-CD3d Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-CD3d Rabbit mAbsynonym : productDescription : NonemolecularWeight : 19 kDaendotoxin :...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike S1 Antibody (NCOV-S1P14-Fc) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike S1 Antibody (NCOV-S1P14-Fc)synonym : null,productDescription : Anti-Spike S1 Antibody (NCOV-S1P14-Fc)(ANA005)...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike RBD Antibody (RP1-E4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-Spike RBD Antibody (RP1-E4)synonym : null,productDescription : Anti-Spike RBD Antibody (RP1-E4)(ANA004)...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike RBD Antibody (RP1-H5) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Spike RBD Antibody (RP1-H5)synonym : null,productDescription : Anti-Spike RBD Antibody (RP1-H5)(ANA003)...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike RBD Antibody (RP6-E2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-Spike RBD Antibody (RP6-E2)synonym : null,productDescription : Anti-Spike RBD Antibody (RP6-E2)(ANA002)...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike RBD Antibody (RP6-E3) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Spike RBD Antibody (RP6-E3)synonym : null,productDescription : Anti-Spike RBD Antibody (RP6-E3)(ANA001)...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-CTLA-8 / IL-17a Antibody (SY18-VHH-11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-CTLA-8 / IL-17a Antibody (SY18-VHH-11)synonym : null,productDescription : Anti-CTLA-8 / IL-17a...
Post Categories Uncategorized Post dateJune 5, 2024Post last updated dateUpdated June 5, 2024 Anti-Spike RBD (Omicron) Antibody (P26130) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Spike RBD (Omicron) Antibody (P26130)synonym : null,productDescription : Anti-Spike RBD (Omicron)...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Spike RBD Antibody (R15-F7) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike RBD Antibody (R15-F7)synonym : null,productDescription : Anti-Spike RBD Antibody (R15-F7)(AHA020)...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Nucleocapsid Antibody (N-P11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Nucleocapsid Antibody (N-P11)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-P11)(AHA018) is expressed...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Nucleocapsid Antibody (N-P10) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Nucleocapsid Antibody (N-P10)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-P10)(AHA017) is expressed...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Calponin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time44 sec read Product Name : Anti-Calponin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 33endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Spike RBD Antibody (R16-F10) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-Spike RBD Antibody (R16-F10)synonym : null,productDescription : Anti-Spike RBD Antibody (R16-F10)(AHA014)...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Spike RBD Antibody (R14-F8) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Spike RBD Antibody (R14-F8)synonym : null,productDescription : Anti-Spike RBD Antibody (R14-F8)(AHA013)...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Nucleocapsid Antibody (N-18) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Nucleocapsid Antibody (N-18)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-18)(AHA009) is expressed...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-ACE2 Antibody (NCOV-7) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-ACE2 Antibody (NCOV-7)synonym : null,productDescription : Anti-ACE2 Antibody (NCOV-7)(AHA007) is expressed...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Nucleocapsid Antibody (N-9) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Nucleocapsid Antibody (N-9)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-9)(AHA006) is expressed...
Post Categories Uncategorized Post dateJune 4, 2024Post last updated dateUpdated June 4, 2024 Anti-Spike RBD Antibody (P17-A11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike RBD Antibody (P17-A11)synonym : null,productDescription : Anti-Spike RBD Antibody (P17-A11)(AHA004)...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-Spike RBD Antibody (P20-B4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike RBD Antibody (P20-B4)synonym : null,productDescription : Anti-Spike RBD Antibody (P20-B4)(AHA003)...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-Spike RBD Antibody (P16-A3) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Spike RBD Antibody (P16-A3)synonym : null,productDescription : Anti-Spike RBD Antibody (P16-A3)(AHA001)...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-NSE Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-NSE Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-HIF-1α Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-HIF-1α Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-Caldesmon Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Caldesmon Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-Gastrin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Gastrin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 11endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-CD99 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CD99 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 19endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-IL-3Ra / CD123 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-IL-3Ra / CD123 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 43endotoxin...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-ZAP-70 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-ZAP-70 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 70endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 3, 2024Post last updated dateUpdated June 3, 2024 Anti-WT1 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-WT1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-VIP Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-VIP Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 19endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-Vimentin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Vimentin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 54endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-Villin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Villin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-VHL Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-VHL Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 24endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-VEGFR2 / KDR / CD309Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-VEGFR2 / KDR / CD309Rabbit mAbsynonym : null,productDescription : NonemolecularWeight :...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-Calcitonin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Calcitonin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 15endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-Tyrosinase Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Tyrosinase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 60endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-β-tubulin-III Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-β-tubulin-III Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-TTF-1 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-TTF-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 39endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 2, 2024Post last updated dateUpdated June 2, 2024 Anti-Tryptase Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Tryptase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 31endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-TPO Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-TPO Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 103endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-TOP2A Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-TOP2A Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 174endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-TIA-1 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-TIA-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 43endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-TS Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-TS Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-Thyroid Stimulating Hormone Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Thyroid Stimulating Hormone Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 16endotoxin...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-TROP2Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-TROP2Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity :...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-CA9 / CAIXMouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-CA9 / CAIXMouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin :...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-Synaptophysin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-Synaptophysin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-STAT6 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-STAT6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 94endotoxin : Nonepurity...
Post Categories Uncategorized Post dateJune 1, 2024Post last updated dateUpdated June 1, 2024 Anti-SOX10 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time44 sec read Product Name : Anti-SOX10 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-Somatostatin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-Somatostatin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 13endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-SMARCA4 / Brg1 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-SMARCA4 / Brg1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 185endotoxin...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-SMA Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-SMA Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-SDHA Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-SDHA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 73endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-S100P Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-S100P Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 10endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-FOLH1 / PSMA Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-FOLH1 / PSMA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 84endotoxin...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-PSAP Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-PSAP Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 58endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-C4d Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-C4d Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 193endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-PSA Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-PSA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 31, 2024Post last updated dateUpdated May 31, 2024 Anti-Protein Gene Product 9.5 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-Protein Gene Product 9.5 Mouse mAbsynonym : null,productDescription : NonemolecularWeight :...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-Podoplanin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Podoplanin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-PMS2 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-PMS2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 96endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-PLAP Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-PLAP Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 58endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-PCNA Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-PCNA Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-Pax8 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Pax8 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 48endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-Pax-5 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-Pax-5 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-p120 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-p120 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 91endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-p63 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-p63 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 77endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-BOB.1 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-BOB.1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 27endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 30, 2024Post last updated dateUpdated May 30, 2024 Anti-p57 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-p57 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 32endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-p27 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-p27 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 22endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-p16 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-p16 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-NSE Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-NSE Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-nm23 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-nm23 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-NGFR Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-NGFR Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 45endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-Neurofilament Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Neurofilament Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 102endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-NeuN Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-NeuN Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-Nestin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Nestin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 177endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-Napsin A Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Napsin A Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 45endotoxin :...
Post Categories Uncategorized Post dateMay 29, 2024Post last updated dateUpdated May 29, 2024 Anti-Bcl-6 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Bcl-6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 79endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-Myoglobin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Myoglobin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-MyoD1 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-MyoD1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 35endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-Myeloperoxidase Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Myeloperoxidase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 84endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-Myelin Basic Protein Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Myelin Basic Protein Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 33endotoxin...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-MUM1 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-MUM1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 79endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-RSV-F Reference Antibody (palivizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-RSV-F Reference Antibody (palivizumab)synonym : null,productDescription : Anti-RSV-F Reference Antibody (palivizumab)(CVA006)...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-RSV-F Reference Antibody (motavizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-RSV-F Reference Antibody (motavizumab)synonym : null,productDescription : Anti-RSV-F Reference Antibody (motavizumab)(CVA005)...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-Rabies virus GP Reference Antibody (rafivirumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-Rabies virus GP Reference Antibody (rafivirumab)synonym : null,productDescription : Anti-Rabies virus...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-Rabies virus GP Reference Antibody (foravirumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-Rabies virus GP Reference Antibody (foravirumab)synonym : null,productDescription : Anti-Rabies virus...
Post Categories Uncategorized Post dateMay 28, 2024Post last updated dateUpdated May 28, 2024 Anti-HBsAg Reference Antibody (OST 577) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-HBsAg Reference Antibody (OST 577)synonym : null,productDescription : Anti-HBsAg Reference Antibody...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-CLDN6 Reference Antibody (IM-302) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (IM-302)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IM-302)...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-MUC6 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-MUC6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 257endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-CLDN6 Reference Antibody (IM-301) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (IM-301)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IM-301)...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Shiga toxin (E.coli) Reference Antibody (setoxaximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Shiga toxin (E.coli) Reference Antibody (setoxaximab)synonym : null,productDescription : Anti-Shiga toxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Shiga toxin (E.coli) Reference Antibody (pritoxaximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Shiga toxin (E.coli) Reference Antibody (pritoxaximab)synonym : null,productDescription : Anti-Shiga toxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Abm Reference Antibody ( IgG4+Kappa Isotype Control) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-Abm Reference Antibody ( IgG4+Kappa Isotype Control)synonym : null,productDescription : Anti-Abm...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Abm Reference Antibody ( IgG1+Kappa Isotype Control) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-Abm Reference Antibody ( IgG1+Kappa Isotype Control)synonym : null,productDescription : Anti-Abm...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-LIV-1 / SLC39A6 Mouse Antibody Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-LIV-1 / SLC39A6 Mouse Antibodysynonym : null,productDescription : Anti-LIV-1 / SLC39A6 Mouse Antibody...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A155) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Tau Reference Antibody (A155)synonym : null,productDescription : NonemolecularWeight : 144.06 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A119) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Tau Reference Antibody (A119)synonym : null,productDescription : NonemolecularWeight : 145.54 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A080) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Tau Reference Antibody (A080)synonym : null,productDescription : NonemolecularWeight : 145.32 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A105) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time54 sec read Product Name : Anti-Tau Reference Antibody (A105)synonym : null,productDescription : NonemolecularWeight : 144.62 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-MUC5AC Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-MUC5AC Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 586endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A103) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Tau Reference Antibody (A103)synonym : null,productDescription : NonemolecularWeight : 143.94 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (A054) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Tau Reference Antibody (A054)synonym : null,productDescription : NonemolecularWeight : 145.12 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (pT217,rabbit IgG1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Tau Reference Antibody (pT217,rabbit IgG1)synonym : null,productDescription : NonemolecularWeight : 139.52...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (pT217,mouse IgG1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Tau Reference Antibody (pT217,mouse IgG1)synonym : null,productDescription : NonemolecularWeight : 141.94...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (pT217,human IgG1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Tau Reference Antibody (pT217,human IgG1)synonym : null,productDescription : NonemolecularWeight : 142.34...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Tau Reference Antibody (posdinemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Tau Reference Antibody (posdinemab)synonym : null,productDescription : NonemolecularWeight : 145.52 kDaendotoxin...
Post Categories Uncategorized Post dateMay 27, 2024Post last updated dateUpdated May 27, 2024 Anti-Amyloid Beta Reference Antibody (Aβab002) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Amyloid Beta Reference Antibody (Aβab002)synonym : null,productDescription : NonemolecularWeight : 147.06...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-Amyloid Beta Reference Antibody (Aβab001) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Amyloid Beta Reference Antibody (Aβab001)synonym : null,productDescription : NonemolecularWeight : 145.36...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-TL1A Reference Antibody (PF-06480605) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-TL1A Reference Antibody (PF-06480605)synonym : productDescription : NonemolecularWeight : 146.54endotoxin :...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-TL1A Reference Antibody (PR200,5C3D11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-TL1A Reference Antibody (PR200,5C3D11)synonym : productDescription : NonemolecularWeight : 144.42endotoxin :...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-MUC2 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-MUC2 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 540endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-MMAE Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-MMAEsynonym : productDescription : NonemolecularWeight : 146.32 KDaendotoxin : <1 EU/mgpurity...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-BSG2 / CD147 Reference Antibody (HcHAb18-DM1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-BSG2 / CD147 Reference Antibody (HcHAb18-DM1)synonym : productDescription : NonemolecularWeight :...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-TL1A Reference Antibody (PR200,1D1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-TL1A Reference Antibody (PR200,1D1)synonym : productDescription : NonemolecularWeight : 144.26 kDaendotoxin...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-CLDN18.2 Reference Antibody (zolbetuximab MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-CLDN18.2 Reference Antibody (zolbetuximab MMAE)synonym : productDescription : .Anti-CLDN18.2 Reference Antibody...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-EGFR & Fc-gamma-RIIIA Reference Antibody (AFM24) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-EGFR & Fc-gamma-RIIIA Reference Antibody (AFM24)synonym : null,productDescription : Anti-EGFR &...
Post Categories Uncategorized Post dateMay 25, 2024Post last updated dateUpdated May 25, 2024 Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(huIgG1-rat IgG2b)) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(huIgG1-rat IgG2b))synonym : null,productDescription : Anti-CD3...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(mIgG2a-rat IgG2b)) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(mIgG2a-rat IgG2b))synonym : null,productDescription : Anti-CD3...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-CD3 & FCRL5 Reference Antibody (Cevostamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD3 & FCRL5 Reference Antibody (Cevostamab)synonym : null,productDescription : Anti-CD3 &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-BAFF & IL-17A Reference Antibody (Tibulizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-BAFF & IL-17A Reference Antibody (Tibulizumab)synonym : null,productDescription : Anti-BAFF &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-CD3 & CD20 Reference Antibody (Epcoritamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD3 & CD20 Reference Antibody (Epcoritamab)synonym : null,productDescription : Anti-CD3 &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-MSH6 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-MSH6 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 153endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-CD3 & BCMA Reference Antibody (Teclistamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD3 & BCMA Reference Antibody (Teclistamab)synonym : null,productDescription : Anti-CD3 &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-CD123 & CD3 Reference Antibody (Flotetuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD123 & CD3 Reference Antibody (Flotetuzumab)synonym : null,productDescription : Anti-CD123 &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-GPRC5D & CD3 Reference Antibody (Talquetamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPRC5D & CD3 Reference Antibody (Talquetamab)synonym : null,productDescription : Anti-GPRC5D &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-IL-1a & IL1b Reference Antibody (Lutikizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IL-1a & IL1b Reference Antibody (Lutikizumab)synonym : null,productDescription : Anti-IL1a &...
Post Categories Uncategorized Post dateMay 24, 2024Post last updated dateUpdated May 24, 2024 Anti-TNFalpha & IL-17 Reference Antibody (ABT122) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFalpha & IL-17 Reference Antibody (ABT122)synonym : null,productDescription : Anti-TNFalpha &...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-ANG2 & VEGFA Reference Antibody (Vanucizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ANG2 & VEGFA Reference Antibody (Vanucizumab)synonym : null,productDescription : Anti-ANG2 &...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-ANG2 & VEGFA Reference Antibody (Faricimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ANG2 & VEGFA Reference Antibody (Faricimab)synonym : null,productDescription : Anti-ANG2 &...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-CD137 & Her2 Reference Antibody (Cinrebafusp alfa) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD137 & Her2 Reference Antibody (Cinrebafusp alfa)synonym : null,productDescription : Anti-CD137...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-LGR5 & EGFR Reference Antibody (Petosemtamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-LGR5 & EGFR Reference Antibody (Petosemtamab)synonym : null,productDescription : Anti-LGR5 &...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-CanAg Reference Antibody (Cantuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CanAg Reference Antibody (Cantuzumab)synonym : null,productDescription : Anti-CanAg Reference Antibody (Cantuzumab)(CHB363)...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-MSH2 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-MSH2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 105endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-EpCAM / TROP1 / CD326 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-EpCAM / TROP1 / CD326 Mouse mAbsynonym : null,productDescription : NonemolecularWeight...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-ADAM9 Reference Antibody (Imgc936) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ADAM9 Reference Antibody (Imgc936)synonym : null,productDescription : Anti-ADAM9 Reference Antibody (Imgc936)(CHA362)...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-GPC2 / Glypican 2 Reference Antibody (Nih Patent Anti-Glypican-2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPC2 / Glypican 2 Reference Antibody (Nih Patent Anti-Glypican-2)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 23, 2024Post last updated dateUpdated May 23, 2024 Anti-MAGE-A4 Reference Antibody (Imc-C103C) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-MAGE-A4 Reference Antibody (Imc-C103C)synonym : null,productDescription : Anti-MAGE-A4 Reference Antibody (Imc-C103C)(CHB360)...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-NAMPT Reference Antibody (Alt-100) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-NAMPT Reference Antibody (Alt-100)synonym : null,productDescription : Anti-NAMPT Reference Antibody (Alt-100)(CHB359)...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-CD93 Reference Antibody (Dcby02) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD93 Reference Antibody (Dcby02)synonym : null,productDescription : Anti-CD93 Reference Antibody (Dcby02)(CHB358)...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-SEZ6 Reference Antibody (Abbv-011) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-SEZ6 Reference Antibody (Abbv-011)synonym : null,productDescription : Anti-SEZ6 Reference Antibody (Abbv-011)(CHB357)...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-TREM2 Reference Antibody (PY314) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TREM2 Reference Antibody (PY314)synonym : null,productDescription : Anti-TREM2 Reference Antibody (Py314)(CHB356)...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-ALP Reference Antibody (Seagen Patent Anti-Alpp) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ALP Reference Antibody (Seagen Patent Anti-Alpp)synonym : null,productDescription : Anti-ALP Reference...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-SLC7A11 Reference Antibody (Agilvax Patent Anti-Slc7A11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-SLC7A11 Reference Antibody (Agilvax Patent Anti-Slc7A11)synonym : null,productDescription : Anti-SLC7A11 Reference...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-Meflin Reference Antibody (Tokai U. Patent Anti-Meflin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Meflin Reference Antibody (Tokai U. Patent Anti-Meflin)synonym : null,productDescription : Anti-Meflin...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-MLH1 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-MLH1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 85endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-CD36 Reference Antibody (Ona Thera Patent Anti-Cd36) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD36 Reference Antibody (Ona Thera Patent Anti-Cd36)synonym : null,productDescription : Anti-CD36...
Post Categories Uncategorized Post dateMay 22, 2024Post last updated dateUpdated May 22, 2024 Anti-CD98 Reference Antibody (Ign523) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD98 Reference Antibody (Ign523)synonym : null,productDescription : Anti-CD98 Reference Antibody (Ign523)(CHB351)...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-PVR / CD155 Reference Antibody (Ntx1088) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-PVR / CD155 Reference Antibody (Ntx1088)synonym : null,productDescription : Anti-PVR /...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-CDCP1 / CD318 Reference Antibody (38 E11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CDCP1 / CD318 Reference Antibody (38 E11)synonym : null,productDescription : Anti-CDCP1...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-MSPR / RON / CD136 Reference Antibody (H5B14) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-MSPR / RON / CD136 Reference Antibody (H5B14)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-Transferrin receptor / CD71 Reference Antibody (Jr-141) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Transferrin receptor / CD71 Reference Antibody (Jr-141)synonym : null,productDescription : Anti-Transferrin...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-Fc gamma R1 Reference Antibody (Medarex Patent Anti-Fc-Gamma-R1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Fc gamma R1 Reference Antibody (Medarex Patent Anti-Fc-Gamma-R1)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-MRC2 / CD280 Reference Antibody (Quark Patent Anti-Endo180) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MRC2 / CD280 Reference Antibody (Quark Patent Anti-Endo180)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-ENPP3 / CD203c Reference Antibody (Ags-16C3F) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ENPP3 / CD203c Reference Antibody (Ags-16C3F)synonym : null,productDescription : Anti-ENPP3 /...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-TM4SF1 Reference Antibody (Beth Israel Patent Anti-TM4SF1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TM4SF1 Reference Antibody (Beth Israel Patent Anti-TM4SF1)synonym : null,productDescription : Anti-TM4SF1...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-MART-1/melan A Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-MART-1/melan A Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 13endotoxin :...
Post Categories Uncategorized Post dateMay 21, 2024Post last updated dateUpdated May 21, 2024 Anti-ROR2 Reference Antibody (Ozuriftamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ROR2 Reference Antibody (Ozuriftamab)synonym : null,productDescription : Anti-ROR2 Reference Antibody (Ozuriftamab)(CHB342)...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab)synonym : null,productDescription : Anti-Siglec-3 /...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-TROP2 Reference Antibody (Datopotamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-TROP2 Reference Antibody (Datopotamab)synonym : null,productDescription : Anti-TROP2 Reference Antibody (Datopotamab)(CHB340)...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (Serclutamab talirine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Serclutamab talirine)synonym : productDescription...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (Laprituximab emtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Laprituximab emtansine)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-MUC16 Reference Antibody (Sofituzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MUC16 Reference Antibody (Sofituzumab vedotin)synonym : productDescription : Sofituzumab vedotin is...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-SLITRK6 Reference Antibody (Sirtratumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-SLITRK6 Reference Antibody (Sirtratumab vedotin)synonym : null,productDescription : Sirtratumab vedotin is...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-TNFSF7 / CD27L / CD70 Reference Antibody (Vorsetuzumab mafodotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFSF7 / CD27L / CD70 Reference Antibody (Vorsetuzumab mafodotin)synonym : productDescription...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-CD79b Reference Antibody (iladatuzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CD79b Reference Antibody (iladatuzumab vedotin)synonym : productDescription : iladatuzumab vedotin is...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-CanAg Reference Antibody (Cantuzumab ravtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CanAg Reference Antibody (Cantuzumab ravtansine)synonym : null,productDescription : Cantuzumab ravtansine is...
Post Categories Uncategorized Post dateMay 20, 2024Post last updated dateUpdated May 20, 2024 Anti-Mammaglobin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Mammaglobin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 10endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-CanAg Reference Antibody (Cantuzumab mertansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-CanAg Reference Antibody (Cantuzumab mertansine)synonym : null,productDescription : Cantuzumab mertansine is...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab ozogamicin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab ozogamicin)synonym : null,productDescription : Gemtuzumab...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-CD19 Reference Antibody (Loncastuximab tesirine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD19 Reference Antibody (Loncastuximab tesirine)synonym : null,productDescription : Loncastuximab tesirine is...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab duocarmazine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab duocarmazine)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-MMAE)synonym : null,productDescription : Anti-Siglec-2 /...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab talirine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab talirine)synonym : null,productDescription : Vadastuximab...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (Cetuximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Cetuximab-MMAE)synonym : productDescription :...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-ERBB3/ HER3 Reference Antibody (Patritumab deruxtecan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB3/ HER3 Reference Antibody (Patritumab deruxtecan)synonym : productDescription : Anti-ERBB3/ HER3...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-FOLR1 / FRA Reference Antibody (mirvetuximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-FOLR1 / FRA Reference Antibody (mirvetuximab-MMAE)synonym : null,productDescription : Anti-FOLR1 Reference...
Post Categories Uncategorized Post dateMay 19, 2024Post last updated dateUpdated May 19, 2024 Anti-TROP2 Reference Antibody (Sacituzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)synonym : null,productDescription : Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)(CHB295)...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-LEF-1 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-LEF-1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 44endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)synonym : null,productDescription : Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)(CHB294)...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-CA9 / CAIX Reference Antibody (girentuximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-CA9 / CAIX Reference Antibody (girentuximab-MMAE)synonym : null,productDescription : Anti-CAIX Reference...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab-MMAE)synonym : null,productDescription : Talacotuzumab-MMAE is...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-MUC1 Reference Antibody (clivatuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time55 sec read Product Name : Anti-MUC1 Reference Antibody (clivatuzumab-MMAE)synonym : productDescription : Clivatuzumab-MMAE is an ADC...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-Endoglin / CD105 Reference Antibody (carotuximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-Endoglin / CD105 Reference Antibody (carotuximab-MMAE)synonym : null,productDescription : Carotuximab-MMAE is...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-AMHR2 Reference Antibody (Murlentamab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-AMHR2 Reference Antibody (Murlentamab-MMAE)synonym : productDescription : Murlentamab-MMAE is an ADC...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-MU5AC Reference Antibody (ensituximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MU5AC Reference Antibody (ensituximab-MMAE)synonym : null,productDescription : Anti-MU5AC Reference Antibody (ensituximab-MMAE)(CHB288)...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-GD3 Reference Antibody (ecromeximab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-GD3 Reference Antibody (ecromeximab-MMAE)synonym : null,productDescription : Anti-GD3 Reference Antibody (ecromeximab-MMAE)(CHB287)...
Post Categories Uncategorized Post dateMay 18, 2024Post last updated dateUpdated May 18, 2024 Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)synonym : null,productDescription : Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)(CHB286)...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-FOLR1 / FRA Reference Antibody (farletuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FOLR1 / FRA Reference Antibody (farletuzumab-MMAE)synonym : null,productDescription : Farletuzumab-MMAE is...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-Langerin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Langerin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-FOLH1 / PSMA Reference Antibody (rosopatamab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab-MMAE)synonym : null,productDescription : Rosopatamab-MMAE is...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-FOLH1 / PSMA Reference Antibody (rosopatamab tetraxetan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab tetraxetan)synonym : null,productDescription : Rosopatamab...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab-MMAE)synonym : null,productDescription : Lorvotuzumab-MMAE is...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab mertansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab mertansine)synonym : null,productDescription : Lorvotuzumab...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab-MMAE)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab emtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab emtansine)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-Mesothelin Reference Antibody (anetumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-Mesothelin Reference Antibody (anetumab-MMAE)synonym : productDescription : Anetumab-MMAE is an ADC...
Post Categories Uncategorized Post dateMay 17, 2024Post last updated dateUpdated May 17, 2024 Anti-Mesothelin Reference Antibody (anetumab ravtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-Mesothelin Reference Antibody (anetumab ravtansine)synonym : null,productDescription : Anetumab ravtansine is...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab-MMAE)synonym : productDescription :...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab ravtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab ravtansine)synonym : productDescription...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-Lambda Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Lambda Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 11endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-ALCAM / CD166 Reference Antibody (Praluzatamab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-ALCAM / CD166 Reference Antibody (Praluzatamab-MMAE)synonym : productDescription : Praluzatamab-MMAE is...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-ALCAM/CD166 Reference Antibody (praluzatamab ravtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-ALCAM/CD166 Reference Antibody (praluzatamab ravtansine)synonym : null,productDescription : Praluzatamab ravtansine is...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-FOLR1 / FRA Reference Antibody (Mirvetuximab soravtansine) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-FOLR1 / FRA Reference Antibody (Mirvetuximab soravtansine)synonym : productDescription : Mirvetuximab...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-TROP2 Reference Antibody (datopotamab deruxtecan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-TROP2 Reference Antibody (datopotamab deruxtecan)synonym : null,productDescription : Datopotamab deruxtecan is...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-MUC16 Reference Antibody (oregovomab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-MUC16 Reference Antibody (oregovomab-MMAE)synonym : null,productDescription : Anti-MUC16 Reference Antibody (oregovomab-MMAE)(CHB269)...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-ERBB3/ HER3 Reference Antibody (patritumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-ERBB3/ HER3 Reference Antibody (patritumab-MMAE)synonym : null,productDescription : Anti-ERBB3/HER3 Reference Antibody...
Post Categories Uncategorized Post dateMay 16, 2024Post last updated dateUpdated May 16, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab-MMAF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab-MMAF)synonym : productDescription :...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-ROR1 Reference Antibody (Zilovertamab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-ROR1 Reference Antibody (Zilovertamab vedotin)synonym : productDescription : zilovertamab vedotin is...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-Siglec-2 / CD22 Reference Antibody (Pinatuzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (Pinatuzumab vedotin)synonym : productDescription : Pinatuzumab...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-ROR2 Reference Antibody (ozuriftamab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ROR2 Reference Antibody (ozuriftamab vedotin)synonym : productDescription : Ozuriftamab vedotin is...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-Ksp Cadherin Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time39 sec read Product Name : Anti-Ksp Cadherin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 90endotoxin :...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab vedotin)synonym : productDescription : Lifastuzumab...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab govitecan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab govitecan)synonym : productDescription...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-GUCY2C Reference Antibody (Indusatumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GUCY2C Reference Antibody (Indusatumab vedotin)synonym : productDescription : Indusatumab vedotin is...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-GPNMB Reference Antibody (Glembatumumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GPNMB Reference Antibody (Glembatumumab vedotin)synonym : productDescription : Glembatumumab vedotin targets...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-CD19 Reference Antibody (denintuzumab-MMAF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-CD19 Reference Antibody (denintuzumab-MMAF)synonym : null,productDescription : Denintuzumab-MMAF is an ADC...
Post Categories Uncategorized Post dateMay 15, 2024Post last updated dateUpdated May 15, 2024 Anti-AXL / UFO Reference Antibody (Enapotamab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-AXL / UFO Reference Antibody (Enapotamab vedotin)synonym : productDescription : Enapotamab...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (tisotumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-CD79b Reference Antibody (Polatuzumab vedotin-piiq) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD79b Reference Antibody (Polatuzumab vedotin-piiq)synonym : productDescription : Polatuzumab vedotin (Polivy)...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-CLM) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-CLM)synonym : null,productDescription : Anti-Siglec-2 /...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-Siglec-3 / CD33 Reference Antibody (gemtuzumab-CLM) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (gemtuzumab-CLM)synonym : null,productDescription : Anti-Siglec-3 /...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-Ki-67 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Ki-67 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 359endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (Disitamab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Disitamab vedotin)synonym : productDescription...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab vedotin)synonym : productDescription : Brentuximab...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab mafodotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab mafodotin)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-LIV-1 / SLC39A6 Reference Antibody (Ladiratuzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-LIV-1 / SLC39A6 Reference Antibody (Ladiratuzumab vedotin)synonym : productDescription : Ladiratuzumab...
Post Categories Uncategorized Post dateMay 14, 2024Post last updated dateUpdated May 14, 2024 Anti-HGFR / c-Met Reference Antibody (Telisotuzumab vedotin) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-HGFR / c-Met Reference Antibody (Telisotuzumab vedotin)synonym : productDescription : Telisotuzumab...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-Nectin-4 Reference Antibody (enfortumab vedotin-ejfv) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Nectin-4 Reference Antibody (enfortumab vedotin-ejfv)synonym : productDescription : Enfortumab vedotin-ejfv is...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab deruxtecan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab deruxtecan)synonym : productDescription...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CLDN6 Reference Antibody (AB1-11) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (AB1-11)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AB1-11)...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CLDN6 Reference Antibody (AB3-7) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (AB3-7)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AB3-7)...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CLDN6 Reference Antibody (64A) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (64A)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (64A)...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-Kappa Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time45 sec read Product Name : Anti-Kappa Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 12endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CLDN6 Reference Antibody (AE3-20) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CLDN6 Reference Antibody (AE3-20)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AE3-20)...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CLDN6 Reference Antibody (DS-9606a) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CLDN6 Reference Antibody (DS-9606a)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (DS-9606a)...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CDH17 / Cadherin-17 Reference Antibody (PTA001_A4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-CDH17 / Cadherin-17 Reference Antibody (PTA001_A4)synonym : null,productDescription : Anti-CDH17 /...
Post Categories Uncategorized Post dateMay 13, 2024Post last updated dateUpdated May 13, 2024 Anti-CDH17 / Cadherin-17 Reference Antibody (10C12) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CDH17 / Cadherin-17 Reference Antibody (10C12)synonym : null,productDescription : Anti-CDH17 /...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-SIRPa / CD172a Reference Antibody (BI 765063) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-SIRPa / CD172a Reference Antibody (BI 765063)synonym : null,productDescription : Anti-SIRPa...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-AXL / UFO Reference Antibody (Tilvestamab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-AXL / UFO Reference Antibody (Tilvestamab-MMAE)synonym : null,productDescription : Tilvestamab-MMAE is...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-KAAG1 Reference Antibody (ADCT-901-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)synonym : null,productDescription : Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)(CHB238)...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-TROP2 Reference Antibody (Sacituzumab govitecan) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TROP2 Reference Antibody (Sacituzumab govitecan)synonym : productDescription : Sacituzumab govitecan is...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-GPC3 / Glypican-3 Reference Antibody (Codrituzumab-MMAE) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time57 sec read Product Name : Anti-GPC3 / Glypican-3 Reference Antibody (Codrituzumab-MMAE)synonym : productDescription : Codrituzumab-MMAE is...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-BTN1A1 Reference Antibody (ICT-01-N297A) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-BTN1A1 Reference Antibody (ICT-01-N297A)synonym : null,productDescription : Anti-BTN1A1 Reference Antibody (ICT-01-N297A)(CHB222)...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-Insulin Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Insulin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 12endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-Bax Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-Bax Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 21 kDaendotoxin :...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-BTN1A1 Reference Antibody (ICT-01) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-BTN1A1 Reference Antibody (ICT-01)synonym : null,productDescription : Anti-BTN1A1 Reference Antibody (ICT-01)(CHB221)...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Anti-AA2AR / Adenosine A2aR Reference Antibody (3F6-9G5) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-AA2AR / Adenosine A2aR Reference Antibody (3F6-9G5)synonym : null,productDescription : Anti-AA2AR...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Molecular-cancer/content/12/1/Page 15 of200 M, then incubated for 1 h at 37 in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Molecular-cancer/content/12/1/Page 15 of200 M, then incubated for 1 h at 37 in culture medium...
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Etastasis of breast cancer cells by way of activating mTORC2/Akt/FOXO3a Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Etastasis of breast cancer cells by means of activating mTORC2/Akt/FOXO3a signaling pathway. Cell Death....
Post Categories Uncategorized Post dateMay 12, 2024Post last updated dateUpdated May 12, 2024 Otypic variations. As opposed to genetic modifications of cell populations, there was small Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Otypic differences. In contrast to genetic modifications of cell populations, there was little time...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-TPBG Reference Antibody (ASN004) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-TPBG Reference Antibody (ASN004)synonym : null,productDescription : Anti-TPBG Reference Antibody (ASN004)...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-TSLP Reference Antibody (tezepelumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TSLP Reference Antibody (tezepelumab)synonym : null,productDescription : Anti-TSLP Reference Antibody (tezepelumab)(CHB216)...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-TGFb1 Reference Antibody (Genzyme patent anti-TGF-β) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-TGFb1 Reference Antibody (Genzyme patent anti-TGF-β)synonym : null,productDescription : Anti-TGFb1 Reference...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-CD19 Reference Antibody (obexelimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CD19 Reference Antibody (obexelimab)synonym : null,productDescription : Anti-CD19 Reference Antibody (obexelimab)(CHB213)...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-IFNAR1 Reference Antibody (Medarex patent anti-IFNAR-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-IFNAR1 Reference Antibody (Medarex patent anti-IFNAR-1)synonym : null,productDescription : Anti-IFNAR1 Reference...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-GD2 Reference Antibody (naxitamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-GD2 Reference Antibody (naxitamab)synonym : null,productDescription : Anti-GD2 Reference Antibody (naxitamab)(CHB210)...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-CEACAM5 / CEA / CD66e Reference Antibody (Immunomedics patent anti-CEACAM5 (Class III)) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Immunomedics patent anti-CEACAM5 (Class...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-CSF1R / M-CSFR / CD115 Reference Antibody (axatilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (axatilimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-INHAMouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time47 sec read Product Name : Anti-INHAMouse mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity :...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Anti-GLP1R Reference Antibody (Centocor patent anti-GLP-1R) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-GLP1R Reference Antibody (Centocor patent anti-GLP-1R)synonym : null,productDescription : Anti-GLP1R Reference...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 N-acetylation needed for ERAD-L|We conclude that N-terminal acetylation of Der Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N-acetylation necessary for ERAD-L|We conclude that N-terminal acetylation of Der1, even though crucial for...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 In animals on both typical salt and high salt diets (21, 22). The Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In animals on each standard salt and higher salt diets (21, 22). The sturdy...
Post Categories Uncategorized Post dateMay 11, 2024Post last updated dateUpdated May 11, 2024 Confident, a forward selection process is employed exactly where essentially the most considerable Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Confident, a forward selection procedure is employed where one of the most significant association...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-VEGF Reference Antibody (BioMab patent anti-VEGF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-VEGF Reference Antibody (BioMab patent anti-VEGF)synonym : null,productDescription : Anti-VEGF Reference...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-ERBB2 / HER2 / CD340 Reference Antibody (BioMab patent anti-Her2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (BioMab patent anti-Her2)synonym :...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-CTLA-4 / CD152 Reference Antibody (Antitope patent anti-CTLA4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-CTLA-4 / CD152 Reference Antibody (Antitope patent anti-CTLA4)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-Amyloid Beta Reference Antibody (lecanemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Amyloid Beta Reference Antibody (lecanemab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-Amyloid Beta Reference Antibody (bapineuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-Amyloid Beta Reference Antibody (bapineuzumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-VEGFR3 / FLT4 Reference Antibody (LY3022856) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time58 sec read Product Name : Anti-VEGFR3 / FLT4 Reference Antibody (LY3022856)synonym : null,productDescription : Anti-VEGFR3 /...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-VEGFR2 / KDR / CD309 Reference Antibody (vulinacimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time56 sec read Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (vulinacimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-VEGFR2 / KDR / CD309 Reference Antibody (AT001) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (AT001)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-VEGFR2 / KDR / CD309 Reference Antibody (alacizumAb) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time59 sec read Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (alacizumAb)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Anti-IMP3 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time46 sec read Product Name : Anti-IMP3 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 22endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 | www.plosone.orgtions, 240 mg/ml FPKc brought on 65.2062.34 cell viability loss, suggesting Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read | www.plosone.orgtions, 240 mg/ml FPKc triggered 65.2062.34 cell viability loss, suggesting some other cytotoxic...
Post Categories Uncategorized Post dateMay 10, 2024Post last updated dateUpdated May 10, 2024 Ites, and traumatic wounds. Arterial, venous, and diabetic leg ulcers Pressure Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ites, and traumatic wounds. Arterial, venous, and diabetic leg ulcers Stress ulcers, post-operative wounds,...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-VEGFC Reference Antibody (VGX100) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-VEGFC Reference Antibody (VGX100)synonym : null,productDescription : Anti-VEGFC Reference Antibody (VGX100)(CHB195)...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-VEGFA Reference Antibody (varisacumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-VEGFA Reference Antibody (varisacumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (varisacumab)(CHB194)...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-VEGFA Reference Antibody (ranibizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-VEGFA Reference Antibody (ranibizumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (ranibizumab)(CHB193)...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-Tau Reference Antibody (zagotenemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Tau Reference Antibody (zagotenemab)synonym : null,productDescription : Anti-Tau Reference Antibody (zagotenemab)(CHB191)...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-VCAM1 / CD106 Reference Antibody (Hanwha patent anti-VCAM-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-VCAM1 / CD106 Reference Antibody (Hanwha patent anti-VCAM-1)synonym : productDescription :...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (vonlerizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (vonlerizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (volociximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (volociximab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-TSPAN26 / CD37 Reference Antibody (AGS67E) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TSPAN26 / CD37 Reference Antibody (AGS67E)synonym : null,productDescription : Anti-TSPAN26 /...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-TSLP Reference Antibody (Schering patent anti-TSLP) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TSLP Reference Antibody (Schering patent anti-TSLP)synonym : null,productDescription : Anti-TSLP Reference...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Anti-TrkB / NTRK2 Reference Antibody (Rinat patent anti-TrkB) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TrkB / NTRK2 Reference Antibody (Rinat patent anti-TrkB)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Sons largely agree involving estimates determined by OGs and those determined Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sons largely agree amongst estimates depending on OGs and these determined according to the...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Ggest that endogenous AA is usually a mediator advertising hypoxic vasoconstriction in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ggest that endogenous AA is often a mediator promoting hypoxic vasoconstriction in the rat...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 . 27. Boivin G, Lips P, Ott SM, et al. Contribution of raloxifene Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read . 27. Boivin G, Lips P, Ott SM, et al. Contribution of raloxifene and...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Preclinical model on which cellular therapy for X-linked SCID was created Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Preclinical model on which cellular therapy for X-linked SCID was created and successfully translated...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 Assay, ARR18 induced an ARR5:LUC construct by about 50 inside the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Assay, ARR18 induced an ARR5:LUC construct by about 50 in the presence of cytokinin...
Post Categories Uncategorized Post dateMay 9, 2024Post last updated dateUpdated May 9, 2024 (Miceli et al., 2009), we decided to investigate whether or not the P574S Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read (Miceli et al., 2009), we decided to investigate irrespective of whether the P574S mutation...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-IgM Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-IgM Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TPBG Reference Antibody (Wyeth patent anti-5T4) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TPBG Reference Antibody (Wyeth patent anti-5T4)synonym : null,productDescription : Anti-TPBG Reference...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-Complement C5 Reference Antibody (vilobelimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Complement C5 Reference Antibody (vilobelimab)synonym : null,productDescription : Anti-Complement C5 Reference...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TIGIT Reference Antibody (vibostolimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TIGIT Reference Antibody (vibostolimab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (vibostolimab)(CHB182)...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TNFSF5 / CD40L / CD154 Reference Antibody (ruplizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFSF5 / CD40L / CD154 Reference Antibody (ruplizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (vedolizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (vedolizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-STEAP1 Reference Antibody (vandortuzumAb) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-STEAP1 Reference Antibody (vandortuzumAb)synonym : null,productDescription : Anti-STEAP1 Reference Antibody (vandortuzumAb)(CHB175)...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TNFSF2 / TNFa Reference Antibody (hMAK195) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (hMAK195)synonym : null,productDescription : Anti-TNFSF2 /...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TNFSF2 / TNFa Reference Antibody (ESBA 105) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (ESBA 105)synonym : null,productDescription : Anti-TNFSF2...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Anti-TNFSF2 / TNFa Reference Antibody (CMAB008) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (CMAB008)synonym : null,productDescription : Anti-TNFSF2 /...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Lls have been cultured and cell lysates have been prepared for immunoblotting or Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Lls had been cultured and cell lysates have been prepared for immunoblotting or immunoprecipitation...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Enterococcus) were absent or in low abundance (i.e., , 1 of culturable Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Enterococcus) had been absent or in low abundance (i.e., , 1 of culturable bacteria)....
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 OnedFigure 12. 7KCh induces crucial ER tension markers and SA inhibits this Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read OnedFigure 12. 7KCh induces important ER pressure markers and SA inhibits this response. ARPE19...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 Velocity and amplitude (Bhat et al., 2001). These electrophysiological modifications are observed Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Velocity and amplitude (Bhat et al., 2001). These electrophysiological adjustments are observed in all...
Post Categories Uncategorized Post dateMay 8, 2024Post last updated dateUpdated May 8, 2024 S, respectively ( p 0.0001, Fig 1A and B, and Supporting Information and facts Fig Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S, respectively ( p 0.0001, Fig 1A and B, and Supporting Details Fig S1)....
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-Amyloid Beta Reference Antibody (U.Zurich patent anti-Amyloid Beta) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-Amyloid Beta Reference Antibody (U.Zurich patent anti-Amyloid Beta)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-IgG4 Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time35 sec read Product Name : Anti-IgG4 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-TNFSF2 / TNFa Reference Antibody (CDP571) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-TNFSF2 / TNFa Reference Antibody (CDP571)synonym : null,productDescription : Anti-TNFSF2 /...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-TNFSF14 / LIGHT / CD258 Reference Antibody (SAR252067) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TNFSF14 / LIGHT / CD258 Reference Antibody (SAR252067)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-TNFSF13B / BAFF / CD257 Reference Antibody (tabalumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-TNFSF13B / BAFF / CD257 Reference Antibody (tabalumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-TNFSF13 / APRIL / CD256 Reference Antibody (sibeprenlimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-TNFSF13 / APRIL / CD256 Reference Antibody (sibeprenlimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-MICB Reference Antibody (U.Washington patent anti-MICB) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-MICB Reference Antibody (U.Washington patent anti-MICB)synonym : null,productDescription : Anti-MICB Reference...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-GAD65 Reference Antibody (U.Washington patent anti-GAD65) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-GAD65 Reference Antibody (U.Washington patent anti-GAD65)synonym : null,productDescription : Anti-GAD65 Reference...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-TNFSF1 / TNFb Reference Antibody (pateclizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time43 sec read Product Name : Anti-TNFSF1 / TNFb Reference Antibody (pateclizumab)synonym : null,productDescription : Anti-TNFSF1 /...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Anti-DCSTAMP Reference Antibody (U.Rochester patent anti-DC-STAMP) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-DCSTAMP Reference Antibody (U.Rochester patent anti-DC-STAMP)synonym : null,productDescription : Anti-DCSTAMP Reference...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Ints and stored in RNAlater (Invitrogen AM7020) for 24 h at four (for Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ints and stored in RNAlater (Invitrogen AM7020) for 24 h at four (for RNA...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Lishment of latent infection, gene expression is limited to a gene Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Lishment of latent infection, gene expression is limited to a gene situated within the...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Th TBSTween 0.1 and incubated using the acceptable horseradish peroxidase conjugated secondary Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Th TBSTween 0.1 and incubated with the appropriate horseradish peroxidase conjugated secondary antibody, followed...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Ein bindJOURNAL OF BIOLOGICAL CHEMISTRYEXPERIMENTAL PROCEDURES Cells and Reagents–THP-1 (National Centre Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ein bindJOURNAL OF BIOLOGICAL CHEMISTRYEXPERIMENTAL PROCEDURES Cells and Reagents–THP-1 (National Centre for Cell Science...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 LsonPagemeasurement noise in the CFSE information [241]. Fitting the model to T Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read LsonPagemeasurement noise inside the CFSE data . Fitting the model to T cell proliferation...
Post Categories Uncategorized Post dateMay 7, 2024Post last updated dateUpdated May 7, 2024 Levels within the perinatal period, substantially increasing the preterm infant’s Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Levels within the perinatal period, considerably escalating the preterm infant’s risk of building invasive...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (ravagalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (ravagalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (mitazalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (mitazalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-IgG Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time35 sec read Product Name : Anti-IgG Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (lucatumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (lucatumumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-TNFRSF5 / CD40 Reference Antibody (iscalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (iscalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-Amyloid Beta Reference Antibody (U.Illinois scFv59) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Amyloid Beta Reference Antibody (U.Illinois scFv59)synonym : null,productDescription : Anti-Amyloid Beta...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-IL-33 Reference Antibody (tozorakimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-IL-33 Reference Antibody (tozorakimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (tozorakimab)(CHB149)...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-IL-33 Reference Antibody (torudokimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-IL-33 Reference Antibody (torudokimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (torudokimab)(CHB148)...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (BMS-986178) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (BMS-986178)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Anti-PDCD1 / PD-1 / CD279 Reference Antibody (toripalimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (toripalimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 To a reaction mixture containing 20 M of phenol red (sodium salt Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read To a reaction mixture containing 20 M of phenol red (sodium salt), 1mM H2O2...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Sport proteins whose expression is regulated by numerous environmental stimuli. They Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sport proteins whose expression is regulated by numerous environmental stimuli. They underline the requirement...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Ogens typically resulting from inherent genetic difficulties, Niacin deficiency on the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ogens typically on account of inherent genetic issues, Niacin deficiency on the other hand...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Mpler (Chemical Data Systems, Oxford, PA, USA) attached to a PerkinElmer Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Mpler (Chemical Information Systems, Oxford, PA, USA) attached to a PerkinElmer GC/MS apparatus (Clarus...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Sidue within the equivalent position to Arg203. (MLK3 numbering) This group Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sidue within the equivalent position to Arg203. (MLK3 numbering) This group was recognized inside...
Post Categories Uncategorized Post dateMay 6, 2024Post last updated dateUpdated May 6, 2024 Hanks buffer eliminate unbound mAbs and incubated on ice with 1 : 1000 dilution Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hanks buffer remove unbound mAbs and incubated on ice with 1 : 1000 dilution...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-CAPRIN1 Reference Antibody (Toray patent anti-Caprin-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-CAPRIN1 Reference Antibody (Toray patent anti-Caprin-1)synonym : null,productDescription : Anti-CAPRIN1 Reference...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-ERBB1 / EGFR / HER1 Reference Antibody (tomuzotuximab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (tomuzotuximab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (lexatumumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (lexatumumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-IgD Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-IgD Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TCR Reference Antibody (TOL101) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-TCR Reference Antibody (TOL101)synonym : null,productDescription : Anti-TCR Reference Antibody (TOL101)(CHB139)...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (benufutamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (benufutamab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (TNX-832) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tilogotamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tilogotamab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (Chugai patent anti-TF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Anti-Tau Reference Antibody (tilavonemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-Tau Reference Antibody (tilavonemab)synonym : null,productDescription : Anti-Tau Reference Antibody (tilavonemab)(CHB133)...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Disruption by means of tight junction translocation and cytoskeletal reorganization inside the human Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Disruption by way of tight junction translocation and cytoskeletal reorganization in the human bronchial...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 N enhanced risk of building subsequent autoimmune ailments (rheumatoid arthritis, multiple Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N enhanced danger of establishing subsequent autoimmune diseases (rheumatoid arthritis, a number of sclerosis,...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Man renal cell carcinoma [24], and glioblastomas [17]. RPLPO and TBP also belonged Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Man renal cell carcinoma , and glioblastomas . RPLPO and TBP also belonged to...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 Ernally located polyester that is certainly becoming cleaved by the enzyme could Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ernally located polyester that is certainly being cleaved by the enzyme might reside in...
Post Categories Uncategorized Post dateMay 5, 2024Post last updated dateUpdated May 5, 2024 F8300DsarA and SF8300DsaeRS. Transcripts of each psma and RNAIII Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read F8300DsarA and SF8300DsaeRS. Transcripts of each psma and RNAIII wereAlpha-type PSMs are Needed for...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-CSF2 / GM-CSF Reference Antibody (Theraclone patent anti-GM-CSF) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time53 sec read Product Name : Anti-CSF2 / GM-CSF Reference Antibody (Theraclone patent anti-GM-CSF)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-Complement C5 Reference Antibody (tesidolumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time43 sec read Product Name : Anti-Complement C5 Reference Antibody (tesidolumab)synonym : null,productDescription : Anti-Complement C5 Reference...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TIGIT Reference Antibody (etigilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-TIGIT Reference Antibody (etigilimab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (etigilimab)(CHB129)...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TGM2 / Transglutaminase 2 Reference Antibody (zampilimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TGM2 / Transglutaminase 2 Reference Antibody (zampilimab)synonym : null,productDescription : Anti-TGM2...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-IDH-1 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-IDH-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TGFb1 Reference Antibody (NIS793) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-TGFb1 Reference Antibody (NIS793)synonym : null,productDescription : Anti-TGFb1 Reference Antibody (NIS793)(CHB126)...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TFPI Reference Antibody (marstacimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TFPI Reference Antibody (marstacimab)synonym : null,productDescription : Anti-TFPI Reference Antibody (marstacimab)(CHB124)...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-Tenascin C Reference Antibody (tenatumomab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Tenascin C Reference Antibody (tenatumomab)synonym : null,productDescription : Anti-Tenascin C Reference...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (telazorlimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (telazorlimab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Anti-TCR Reference Antibody (NKTT320) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-TCR Reference Antibody (NKTT320)synonym : null,productDescription : Anti-TCR Reference Antibody (NKTT320)(CHB118)...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Answer (SK-5300, Vector Blue). They had been then incubated having a rabbit Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Remedy (SK-5300, Vector Blue). They had been then incubated using a rabbit anti-active caspase-3...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Ce, a situation that impairs voltage control. To overcome this trouble Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ce, a situation that impairs voltage control. To overcome this problem, we applied an...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 D DNA synthesis by blocking uridine transport, therefore, inhibiting the pyrimidine Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D DNA synthesis by blocking uridine transport, as a result, inhibiting the pyrimidine salvage...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Of HIC in any purification procedure presents two main challenges. In Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Of HIC in any purification method presents two primary challenges. Generally, binding capacity has...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Ophobic and charged residues could mediate the NLRP3 inflammasome assembly (28). Could Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ophobic and charged residues may mediate the NLRP3 inflammasome assembly (28). Could these AIM2-specific...
Post Categories Uncategorized Post dateMay 4, 2024Post last updated dateUpdated May 4, 2024 Nin-8 (CCK-8) (Degorter et al., 2012), suggesting that these amino acids are Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nin-8 (CCK-8) (Degorter et al., 2012), suggesting that these amino acids are certainly involved...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-TBFbR2 Reference Antibody (LY3022859) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time48 sec read Product Name : Anti-TBFbR2 Reference Antibody (LY3022859)synonym : null,productDescription : Anti-TBFbR2 Reference Antibody (LY3022859)(CHB117)...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-PCSK9 Reference Antibody (tafolecimab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-PCSK9 Reference Antibody (tafolecimab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (tafolecimab)(CHB115)...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-Tau Reference Antibody (bepranemab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-Tau Reference Antibody (bepranemab)synonym : null,productDescription : Anti-Tau Reference Antibody (bepranemab)(CHB113)...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-Integrin a2b3 (ITGA2 & ITGB3) Reference Antibody (tadocizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Integrin a2b3 (ITGA2 & ITGB3) Reference Antibody (tadocizumab)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)synonym : null,productDescription : Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)(CHB110)...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-HSA Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-HSA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-Amyloid Beta Reference Antibody (solanezumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Amyloid Beta Reference Antibody (solanezumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-NaPi2b / SLC34A2 Reference Antibody (upifitamab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-NaPi2b / SLC34A2 Reference Antibody (upifitamab)synonym : null,productDescription : Anti-SLC34A2 Reference...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-SLC2A8 Reference Antibody (VB1-050) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-SLC2A8 Reference Antibody (VB1-050)synonym : null,productDescription : Anti-SLC2A8 Reference Antibody (VB1-050)(CHB104)...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Anti-SLAMF7 / CS1 Reference Antibody (PDL241) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-SLAMF7 / CS1 Reference Antibody (PDL241)synonym : null,productDescription : Anti-SLAMF7 /...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 The anti-tumor activity of 5-FU by apoptosis, inhibition of proliferation and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The anti-tumor activity of 5-FU by apoptosis, inhibition of proliferation and colony formation of...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Ss could result in Fas-mediated apoptosis. Nonetheless, the JNK pathway is Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ss could lead to Fas-mediated apoptosis. Nevertheless, the JNK pathway can also be involved...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Tively impacts cardiac glucose uptake and insulin sensitivity following ischemic injury Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tively impacts cardiac glucose uptake and insulin sensitivity following ischemic injury and eventually results...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Mann et al., 2012) were decrease than reported in previous studies. Two Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Mann et al., 2012) have been decrease than reported in preceding studies. Two of...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 Onds sustaining the structures of your ECD linker domain along with the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Onds sustaining the structures with the ECD linker domain plus the ECLs within the...
Post Categories Uncategorized Post dateMay 3, 2024Post last updated dateUpdated May 3, 2024 G of sodium citrate in 1000 mL of DEPC-treated water. paraformaldehyde (PFA Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read G of sodium citrate in 1000 mL of DEPC-treated water. paraformaldehyde (PFA) for 15...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-SLAMF7 / CS1 Reference Antibody (azintuxizumAb) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-SLAMF7 / CS1 Reference Antibody (azintuxizumAb)synonym : null,productDescription : Anti-SLAMF7 /...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-3 / CD33 Reference Antibody (IMGN779) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-Siglec-3 / CD33 Reference Antibody (IMGN779)synonym : null,productDescription : Anti-Siglec-3 /...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-2 / CD22 Reference Antibody (pinatuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time52 sec read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (pinatuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-2 / CD22 Reference Antibody (NCI m972) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (NCI m972)synonym : null,productDescription : Anti-Siglec-2...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-2 / CD22 Reference Antibody (NCI m971) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (NCI m971)synonym : null,productDescription : Anti-Siglec-2...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-2 / CD22 Reference Antibody (epratuzumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Siglec-2 / CD22 Reference Antibody (epratuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-HNF1 Beta Rabbit mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-HNF1 Beta Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 61endotoxin :...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-15 / CD33L3 Reference Antibody (Medimmune patent anti-Siglec-15) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (Medimmune patent anti-Siglec-15)synonym : null,productDescription :...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-Siglec-15 / CD33L3 Reference Antibody (AB-25E9) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (AB-25E9)synonym : null,productDescription : Anti-Siglec-15 /...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Anti-BST2 / CD317 Reference Antibody (SBI Biotech patent anti-BST2) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-BST2 / CD317 Reference Antibody (SBI Biotech patent anti-BST2)synonym : null,productDescription...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 A schematic form a summary with the strongest baseline predictors of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read A schematic form a summary on the strongest baseline predictors of your gains in...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Nmethylated, respectively (Zilberman et al., 2007). According to the information from Zilberman Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nmethylated, respectively (Zilberman et al., 2007). Determined by the information from Zilberman et al....
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Nditions, WT mice showed standard regenerating crypts (Figure 3D). Additional determination Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nditions, WT mice showed typical regenerating crypts (Figure 3D). Further determination on the proliferation...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 The existing SP resistance based on quintuple mutations in Tanzania.in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The existing SP resistance according to quintuple mutations in Tanzania.in every single experiment. Digestion...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 In IL-1 production, therefore indicating its function in the production of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In IL-1 production, as a result indicating its role in the production from the...
Post Categories Uncategorized Post dateMay 2, 2024Post last updated dateUpdated May 2, 2024 Taneously enhance even if assigned to placebo. These situations make it Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Taneously increase even if assigned to placebo. These situations make it difficult two to...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-S100A4 Reference Antibody (LK-1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time50 sec read Product Name : Anti-S100A4 Reference Antibody (LK-1)synonym : null,productDescription : Anti-S100A4 Reference Antibody (LK-1)(CHB091)...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-RTN4 / NOGO Reference Antibody (NG-101) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-RTN4 / NOGO Reference Antibody (NG-101)synonym : null,productDescription : Anti-RTN4 /...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-RTN4 / NOGO Reference Antibody (atinumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-RTN4 / NOGO Reference Antibody (atinumab)synonym : null,productDescription : Anti-RTN4 /...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-RHD / CD240d Reference Antibody (LFB Anti-RhD) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-RHD / CD240d Reference Antibody (LFB Anti-RhD)synonym : null,productDescription : Anti-RHD...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-RAMP3 Reference Antibody (Medella patent anti-RAMP-3) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time49 sec read Product Name : Anti-RAMP3 Reference Antibody (Medella patent anti-RAMP-3)synonym : null,productDescription : Anti-RAMP3 Reference...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-RHD / CD240d Reference Antibody (roledumab) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-RHD / CD240d Reference Antibody (roledumab)synonym : null,productDescription : Anti-RHD /...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-Amyloid Beta Reference Antibody (Rockefeller U. patent anti-Amyloid Beta) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time51 sec read Product Name : Anti-Amyloid Beta Reference Antibody (Rockefeller U. patent anti-Amyloid Beta)synonym : null,productDescription...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-PMELMouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-PMELMouse mAbsynonym : null,productDescription : NonemolecularWeight : 70endotoxin : Nonepurity :...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-ATRX Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-ATRX Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 283 kDaendotoxin :...
Post Categories Uncategorized Post dateApril 29, 2024Post last updated dateUpdated April 29, 2024 Anti-Bcl-2 Mouse mAb Post author Ubiquitin Ligase- ubiquitin-ligasePost read time36 sec read Product Name : Anti-Bcl-2 Mouse mAbsynonym : productDescription : NonemolecularWeight : 18 kDaendotoxin :...
Post Categories Uncategorized Post dateApril 27, 2024Post last updated dateUpdated April 27, 2024 Atient has suffered from low progressive skeletal myopathy considering that childhood. Given that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Atient has suffered from low progressive skeletal myopathy considering that childhood. Considering that five...
Post Categories Uncategorized Post dateApril 27, 2024Post last updated dateUpdated April 27, 2024 N PFS by investigator assessment.* Univariate evaluation Baseline variable Therapy (lenalidomide Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N PFS by investigator assessment.* Univariate analysis Baseline variable Remedy (lenalidomide versus IC) MIPI-based...
Post Categories Uncategorized Post dateApril 27, 2024Post last updated dateUpdated April 27, 2024 H before TGI, Total proteins have been isolated from the hippocampal CA Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read H ahead of TGI, Total proteins have been isolated from the hippocampal CA1 subfield...
Post Categories Uncategorized Post dateApril 25, 2024Post last updated dateUpdated April 25, 2024 E finish receptor occupancy and degradation. Consequently, we investigated the results Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E full receptor occupancy and degradation. Hence, we investigated the effects of FTY720 treatment...
Post Categories Uncategorized Post dateApril 25, 2024Post last updated dateUpdated April 25, 2024 Ent of spontaneous seizures after SEAuthor Manuscript Writer Manuscript Author Manuscript Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ent of spontaneous seizures after SEAuthor Manuscript Writer Manuscript Writer Manuscript Writer ManuscriptAlthough the...
Post Categories Uncategorized Post dateApril 25, 2024Post last updated dateUpdated April 25, 2024 Ells is induced throughout the early phase of CSFV infection, indicating Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ells is induced through the early phase of CSFV infection, indicating that CSFV can...
Post Categories Uncategorized Post dateApril 4, 2024Post last updated dateUpdated April 4, 2024 Seedlings beneath non-HS situations. The information had at the very least 3 biological Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Seedlings below non-HS situations. The information had at the least three biological replicates and...
Post Categories Uncategorized Post dateApril 4, 2024Post last updated dateUpdated April 4, 2024 Samples were kept protected from light for 24 h at RT before Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Samples have been kept protected from light for 24 h at RT just before...
Post Categories Uncategorized Post dateApril 2, 2024Post last updated dateUpdated April 2, 2024 Pattern recognition molecules (PRMs) to their ligands, i.e., binding of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Pattern recognition molecules (PRMs) to their ligands, i.e., binding of C1q to antigenantibody complexes...
Post Categories Uncategorized Post dateApril 2, 2024Post last updated dateUpdated April 2, 2024 F protein crowders (A and B) Diffusion coefficients (A) and photos Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read F protein crowders (A and B) Diffusion coefficients (A) and images from confocal microscopy...
Post Categories Uncategorized Post dateApril 2, 2024Post last updated dateUpdated April 2, 2024 Hich was accompanied by the reversal of EMT plus the suppression Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hich was accompanied by the reversal of EMT as well as the suppression of...
Post Categories Uncategorized Post dateApril 1, 2024Post last updated dateUpdated April 1, 2024 Logy in Tg (PCSK9) mice indicates the lack of PCSK9 influences Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Logy in Tg (PCSK9) mice indicates the lack of PCSK9 influences testicular function and...
Post Categories Uncategorized Post dateApril 1, 2024Post last updated dateUpdated April 1, 2024 The COVID-19 pandemic. Supplementary data to this short article is usually located Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The COVID-19 pandemic. Supplementary data to this short article can be identified online at...
Post Categories Uncategorized Post dateApril 1, 2024Post last updated dateUpdated April 1, 2024 Inciple elements of ancestry applying data from select CpG web pages (32). To Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Inciple components of ancestry working with details from select CpG web-sites (32). To adjust...
Post Categories Uncategorized Post dateMarch 31, 2024Post last updated dateUpdated March 31, 2024 Carrier 19 loved ones (SLC19) of transporters which conform to the significant facilitator Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Carrier 19 loved ones (SLC19) of transporters which conform for the main facilitator superfamily...
Post Categories Uncategorized Post dateMarch 31, 2024Post last updated dateUpdated March 31, 2024 Enough to alleviate pain in OA, and opioids can create considerable Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Enough to alleviate discomfort in OA, and opioids can make considerable adverse effects including...
Post Categories Uncategorized Post dateMarch 31, 2024Post last updated dateUpdated March 31, 2024 Or on the neurotransmitters. Nevertheless, even though the transmitter involved in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Or in the neurotransmitters. However, even though the transmitter involved inside the activity could...
Post Categories Uncategorized Post dateMarch 30, 2024Post last updated dateUpdated March 30, 2024 D in the DNA damage-induced, p53-dependent WIP1 transcript regulation. The Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D from the DNA damage-induced, p53-dependent WIP1 transcript regulation. The increased WIP1 expression by...
Post Categories Uncategorized Post dateMarch 30, 2024Post last updated dateUpdated March 30, 2024 Vitro three.three. ADAR2 Prevents Hepatocyte from Lipid Accumulation In VitroTo investigate the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Vitro 3.three. ADAR2 Prevents Hepatocyte from Lipid Accumulation In VitroTo investigate the effects of...
Post Categories Uncategorized Post dateMarch 30, 2024Post last updated dateUpdated March 30, 2024 E high-quality evidence and standardized remedy, and the rate of utilization Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E high-quality evidence and standardized treatment, as well as the price of utilization of...
Post Categories Uncategorized Post dateMarch 28, 2024Post last updated dateUpdated March 28, 2024 Ting (WB) (Figure 4d, Figure S19, Supporting Data), which showed that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ting (WB) (Figure 4d, Figure S19, Supporting Data), which showed that each SpAcDex-ATMO-21 NPs...
Post Categories Uncategorized Post dateMarch 28, 2024Post last updated dateUpdated March 28, 2024 Against fruit rot pathogens under in vitro circumstances; (4) to assess the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Against fruit rot pathogens under in vitro conditions; (four) to assess the in vivo...
Post Categories Uncategorized Post dateMarch 28, 2024Post last updated dateUpdated March 28, 2024 Ier survival curves have been derived from the KM plotter database (http Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ier survival curves had been derived from the KM plotter database (http://kmplot). The Cox...
Post Categories Uncategorized Post dateMarch 27, 2024Post last updated dateUpdated March 27, 2024 In Figure 6, the sensory evaluation benefits abA 2 10.14 0.30effect on RC-SSP, though Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In Figure six, the sensory evaluation outcomes abA two ten.14 0.30effect on RC-SSP, when...
Post Categories Uncategorized Post dateMarch 27, 2024Post last updated dateUpdated March 27, 2024 Re AR and virulence genes, respectively. (A) Connections connections. Nodes in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Re AR and virulence genes, respectively. (A) Connections connections. Nodes in orange and blue...
Post Categories Uncategorized Post dateMarch 27, 2024Post last updated dateUpdated March 27, 2024 Or predicting HVPG 12 mm Hg and hence could pretty predict the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Or predicting HVPG 12 mm Hg and hence could pretty predict the presence of...
Post Categories Uncategorized Post dateMarch 26, 2024Post last updated dateUpdated March 26, 2024 He crucial point of TBI remedy. EA has an protective effect Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read He crucial point of TBI therapy. EA has an protective effect around the nervous...
Post Categories Uncategorized Post dateMarch 26, 2024Post last updated dateUpdated March 26, 2024 D not proliferate for the duration of overnight culture, Raji cells slightly proliferated, and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D not proliferate through overnight culture, Raji cells slightly proliferated, and Jurkat and JINB8...
Post Categories Uncategorized Post dateMarch 26, 2024Post last updated dateUpdated March 26, 2024 D) AZD4547. Data are represented as a percentage .E.M.Figure Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D) AZD4547. Data are represented as a percentage .E.M.Figure 5. CAM-PDX chemotherapy resistance is...
Post Categories Uncategorized Post dateMarch 25, 2024Post last updated dateUpdated March 25, 2024 0 or 1 Accessible tumor tissue No prior therapy for sophisticated gastric/GEJ Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 0 or 1 Offered tumor tissue No prior remedy for advanced gastric/GEJ cancer Stratification...
Post Categories Uncategorized Post dateMarch 24, 2024Post last updated dateUpdated March 24, 2024 three mg/ml) as substrates. A. xylosoxidans ATCC 27061 and P. aeruginosa ATCC Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 3 mg/ml) as substrates. A. xylosoxidans ATCC 27061 and P. aeruginosa ATCC 27853 had...
Post Categories Uncategorized Post dateMarch 24, 2024Post last updated dateUpdated March 24, 2024 Level of ATPBonferr test: chi square = 34.587, df = three, p = 0.025). (C) Inside the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Quantity of ATPBonferr test: chi square = 34.587, df = three, p = 0.025)....
Post Categories Uncategorized Post dateMarch 24, 2024Post last updated dateUpdated March 24, 2024 Ting Details: Appendix S2. NVivo 12 application (QSR International) was applied to Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ting Facts: Appendix S2. NVivo 12 application (QSR International) was applied to boost the...
Post Categories Uncategorized Post dateMarch 23, 2024Post last updated dateUpdated March 23, 2024 Ed making use of Byologic software (Protein Metrics Inc., San Carlos, CA), which Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ed employing Byologic computer software (Protein Metrics Inc., San Carlos, CA), which utilizes extracted...
Post Categories Uncategorized Post dateMarch 23, 2024Post last updated dateUpdated March 23, 2024 Y was performed in 1956, however the official transplant plan was only Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Y was performed in 1956, however the official transplant system was only six years...
Post Categories Uncategorized Post dateMarch 23, 2024Post last updated dateUpdated March 23, 2024 N a multidimensional no cost power surface implicit of solvent coordinates primarily based Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N a multidimensional no cost power surface implicit of solvent coordinates primarily based around...
Post Categories Uncategorized Post dateMarch 22, 2024Post last updated dateUpdated March 22, 2024 90).Fc Oglycosylation from human IgG usion glycoproteinsThe IgG Fc is a Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 90).Fc Oglycosylation from human IgG usion glycoproteinsThe IgG Fc is a homodimer connected by...
Post Categories Uncategorized Post dateMarch 22, 2024Post last updated dateUpdated March 22, 2024 Ing MBNL1 (Muscleblind Like Splicing Regulator 1) expression enhancers, and toxic RNA Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ing MBNL1 (Muscleblind Like Splicing Regulator 1) expression enhancers, and toxic RNA degradation ....
Post Categories Uncategorized Post dateMarch 22, 2024Post last updated dateUpdated March 22, 2024 On for eight weeks, the mastering and memory capacity of the mice Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read On for 8 weeks, the learning and memory capacity of your mice in the...
Post Categories Uncategorized Post dateMarch 20, 2024Post last updated dateUpdated March 20, 2024 Ne ASCT and reserve it for progressive illness. Ultimately, although consolidation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ne ASCT and reserve it for progressive disease. Lastly, while consolidation therapy post transplantation...
Post Categories Uncategorized Post dateMarch 20, 2024Post last updated dateUpdated March 20, 2024 In the PES minima. One example is, it was shown that [N Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In the PES minima. For example, it was shown that has two accessible steady...
Post Categories Uncategorized Post dateMarch 20, 2024Post last updated dateUpdated March 20, 2024 Ubchondral bone may behave as a disease-modifying role within the progression Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ubchondral bone may behave as a disease-modifying part in the progression of knee OA....
Post Categories Uncategorized Post dateMarch 19, 2024Post last updated dateUpdated March 19, 2024 N the presence of Ca2+ ions, alginate solutions can type gels Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N the presence of Ca2+ ions, alginate solutions can form gels by cooperative interaction...
Post Categories Uncategorized Post dateMarch 19, 2024Post last updated dateUpdated March 19, 2024 E variety; HTN = hypertension; HLD = hyperlipidemia; DM = Diabetes Mellitus; CAD = coronary Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read E range; HTN = hypertension; HLD = hyperlipidemia; DM = Diabetes Mellitus; CAD =...
Post Categories Uncategorized Post dateMarch 19, 2024Post last updated dateUpdated March 19, 2024 Processes due to the fact they may be distributed in many immuneresponsive cell subsets that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Processes mainly because they’re distributed in different immuneresponsive cell subsets that coordinate the adaptive...
Post Categories Uncategorized Post dateMarch 17, 2024Post last updated dateUpdated March 17, 2024 Shown by mean of triplicates EM (left y-axis; break indicates the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Shown by mean of triplicates EM (left y-axis; break indicates the cut-off in the...
Post Categories Uncategorized Post dateMarch 17, 2024Post last updated dateUpdated March 17, 2024 King status (under no circumstances; former; light; moderate and heavy) plus the poverty Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read King status (by no means; former; light; moderate and heavy) and also the poverty...
Post Categories Uncategorized Post dateMarch 17, 2024Post last updated dateUpdated March 17, 2024 Corresponding to Asn118 in XEEL. Most structural calcium residues have been found Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Corresponding to Asn118 in XEEL. Most structural calcium residues had been located to cluster...
Post Categories Uncategorized Post dateMarch 16, 2024Post last updated dateUpdated March 16, 2024 Showed higher levels of proliferation and low background levels of apoptosis Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Showed high levels of proliferation and low background levels of apoptosis (Fig. 7A )....
Post Categories Uncategorized Post dateMarch 16, 2024Post last updated dateUpdated March 16, 2024 Fluid environment situations was evaluated by due to the ploughing of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Fluid atmosphere conditions was evaluated by as a consequence of the ploughing of really...
Post Categories Uncategorized Post dateMarch 16, 2024Post last updated dateUpdated March 16, 2024 Ics, and fine targeting properties. This study focused at developing physically Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ics, and fine targeting properties. This study focused at creating physically stable DOX-LPHNs formulation...
Post Categories Uncategorized Post dateMarch 14, 2024Post last updated dateUpdated March 14, 2024 The future, adequate amounts of purified MSCs has to be obtained [40, 41]. Nevertheless Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The future, enough amounts of purified MSCs have to be obtained . However,...
Post Categories Uncategorized Post dateMarch 14, 2024Post last updated dateUpdated March 14, 2024 Ferences in human and mouse cardiac electrophysiology, the mechanisms of intracellular Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ferences in human and mouse cardiac electrophysiology, the mechanisms of intracellular Ca2+ regulation are...
Post Categories Uncategorized Post dateMarch 13, 2024Post last updated dateUpdated March 13, 2024 H the following therapeutic treatment possibilities: single dose IV oritavancin, dalbavancin Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read H the following therapeutic remedy solutions: single dose IV oritavancin, dalbavancin (either as a...
Post Categories Uncategorized Post dateMarch 12, 2024Post last updated dateUpdated March 12, 2024 Atment (EOT) in nonresponders. Tumors of patients 002-10(12) and 005-11(14) displayed Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Atment (EOT) in nonresponders. Tumors of individuals 002-10(12) and 005-11(14) displayed a reduction in...
Post Categories Uncategorized Post dateMarch 11, 2024Post last updated dateUpdated March 11, 2024 Inside the very first 1, using the stepwise process, we determined the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In the initially 1, making use of the stepwise procedure, we determined the percentage...
Post Categories Uncategorized Post dateMarch 10, 2024Post last updated dateUpdated March 10, 2024 Ens. Secondary endpoints had been thus objective response price (ORR), illness handle Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ens. Secondary endpoints have been hence objective response rate (ORR), illness handle price (DCR),...
Post Categories Uncategorized Post dateMarch 9, 2024Post last updated dateUpdated March 9, 2024 Patient remained in remission until 2010. In June 2010 patient presented with fever Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Patient remained in remission till 2010. In June 2010 patient presented with fever, malaise,...
Post Categories Uncategorized Post dateMarch 8, 2024Post last updated dateUpdated March 8, 2024 On to 0 MYH91676-1791 treated cells.by direct interaction with viral Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read On to 0 MYH91676-1791 treated cells.by direct interaction with viral GP5 (Li et al.,...
Post Categories Uncategorized Post dateMarch 8, 2024Post last updated dateUpdated March 8, 2024 M was utilised for MS acquisition in unfavorable ionization mode. The Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read M was used for MS acquisition in negative ionization mode. The mass spectrum parameters...
Post Categories Uncategorized Post dateMarch 8, 2024Post last updated dateUpdated March 8, 2024 Ne None None None 3 months just after ASCT 1.510 14.160 two.950 1.131 five.250 10.380 36.180 16.670 1.590 Reference values five.five 015 3.3 two.five 7 34 35 25 4.carbohydrate Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ne None None None Three months immediately after ASCT 1.510 14.160 2.950 1.131 five.250...
Post Categories Uncategorized Post dateMarch 7, 2024Post last updated dateUpdated March 7, 2024 Ation. The present work was performed by J-GZ in partial fulfillment Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ation. The present perform was performed by J-GZ in partial fulfillment in the requirements...
Post Categories Uncategorized Post dateMarch 7, 2024Post last updated dateUpdated March 7, 2024 Housekeeping genes were synthesized and procured from Sigma Aldrich. Agarose gel Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Housekeeping genes have been synthesized and procured from Sigma Aldrich. Agarose gel electrophoresis wasS...
Post Categories Uncategorized Post dateMarch 7, 2024Post last updated dateUpdated March 7, 2024 Holesterol, and LDL in sufferers with sufferers with hypercholesterolemia, compared with Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Holesterol, and LDL in patients with patients with hypercholesterolemia, compared with levels developed erides,...
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 The North American Association of Central Cancer Registries Hispanic Identification Algorithm Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The North American Association of Central Cancer Registries Hispanic Identification Algorithm . Due to...
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 Group before DFT and also the imply MAP from the DFT- group Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Group ahead of DFT and the mean MAP in the DFT- group were compared....
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 Ational imply to become stunted, underweight, or malnourished, respectively. Raw scores Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ational mean to be stunted, underweight, or malnourished, respectively. Raw scores obtained in the...
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 OparticlesThe antiretroviral activities of EuCF-DTG and FA-EuCF-DTG nanoparticles were assessed in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read OparticlesThe antiretroviral activities of EuCF-DTG and FA-EuCF-DTG nanoparticles were assessed in MDM infected with...
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 Minority accrual to clinical trials have been published, the challenge remains Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Minority accrual to clinical trials have already been published, the challenge remains to 1st...
Post Categories Uncategorized Post dateMarch 4, 2024Post last updated dateUpdated March 4, 2024 Lyzed making use of Kaplan eier model and Cox proportional hazards models. All Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Lyzed working with Kaplan eier model and Cox proportional hazards models. All estimates are...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 F the pregnant ladies in the study was 24.7 four.1 years, and number Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read F the pregnant ladies within the study was 24.7 4.1 years, and quantity of...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 On. 2016;38:9. von Meyenn F, Iurlaro M, Habibi E, Liu NQ, Salehzadeh-Yazdi Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read On. 2016;38:9. von Meyenn F, Iurlaro M, Habibi E, Liu NQ, Salehzadeh-Yazdi A, Santos...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 Tion 1:1000 (1 h, room temp.). The rinsings of probes in buffered NaCl Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tion 1:1000 (1 h, room temp.). The rinsings of probes in buffered NaCl solution...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 Nism underlying this abdominal pain . Hypersensitivity refers towards the enhanced sensation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nism underlying this abdominal pain . Hypersensitivity refers for the increased sensation of stimuli:...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 S also led us to seek out that inhibiting ALDH1A3 led Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S also led us to find that inhibiting ALDH1A3 led to a lower of...
Post Categories Uncategorized Post dateMarch 3, 2024Post last updated dateUpdated March 3, 2024 Gents that induced a modify in pHi or [Ca2+]i, statistical Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Gents that induced a change in pHi or i, statistical evaluation was performed by...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 Swiftly induces muscle insulin resistance for glucose uptake by means of the activation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Quickly induces muscle insulin resistance for glucose uptake by way of the activation of...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 D endothelial cells) that we previously created from sorted CRC cell Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D endothelial cells) that we previously developed from sorted CRC cell populations (Isella et...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 On, deregulation of cell survival at the same time as proliferation, invasion and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read On, deregulation of cell survival as well as proliferation, invasion and angiogenesis . Having...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 Infection and lysis,191 antitumor immune response induction22,23 and acute vascular disruption. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Infection and lysis,191 antitumor immune response induction22,23 and acute vascular disruption.24 PexaVec is derived...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 Node metastasis had been considerable predictors of PFS. However both anti-p53 antibody Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Node metastasis had been significant predictors of PFS. Even so both anti-p53 antibody and...
Post Categories Uncategorized Post dateMarch 2, 2024Post last updated dateUpdated March 2, 2024 Ctivation in the STINGAugust 2017 Volume 91 Problem 16 e00535-17 jvi.asm.orgDeschamps Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ctivation on the STINGAugust 2017 Volume 91 Concern 16 e00535-17 jvi.asm.orgDeschamps and KalamvokiJournal of...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 E have been walking at 15cm/s. The video photos had been recorded Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E have been walking at 15cm/s. The video photos were recorded and analyzed with...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 S. In addition, protein spot 167 also belonged to this pattern in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S. Moreover, protein spot 167 also belonged to this pattern in Yunong 3114, when...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 Ory syncytial viruses, exportinsIntroduction: the Global Health ProblemViral respiratory illness (VRD Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ory syncytial viruses, exportinsIntroduction: the International Overall health ProblemViral respiratory illness (VRD) benefits inside...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 Doped or undoped, are applied to simulate the unique regional environments Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Doped or undoped, are utilised to simulate the unique nearby environments explored by a...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 Th or with no asthma [11]. Increasing proof points for the truth that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Th or without having asthma . Increasing proof points to the truth that the...
Post Categories Uncategorized Post dateMarch 1, 2024Post last updated dateUpdated March 1, 2024 Herols, IU/kg Lauric acid [12:0] Myristic acid [14:0] Palmitic acid [16:0] Stearic acid Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Herols, IU/kg Lauric acid Myristic acid Palmitic acid Stearic acid ...
Post Categories Uncategorized Post dateFebruary 29, 2024Post last updated dateUpdated February 29, 2024 Sease in JHMV-infected mice, irrespective if transplanted with GFP-NPCs or handled Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sease in JHMV-infected mice, regardless if transplanted with GFP-NPCs or taken care of with...
Post Categories Uncategorized Post dateFebruary 29, 2024Post last updated dateUpdated February 29, 2024 T HSCT. There have been no mismatches in the ABO blood groups. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read T HSCT. There were no mismatches from the ABO blood groups. Taken with each...
Post Categories Uncategorized Post dateFebruary 29, 2024Post last updated dateUpdated February 29, 2024 In DMSO situations). Transient transfection siRNA and mimics. siRNA (MUC1, HIF Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In DMSO situations). Transient transfection siRNA and mimics. siRNA (MUC1, HIF2A, All Stars Damaging...
Post Categories Uncategorized Post dateFebruary 28, 2024Post last updated dateUpdated February 28, 2024 Erial clearance rates, increases neutrophil surface adhesion molecule expression, enhances neutrophil Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Erial clearance rates, increases neutrophil surface adhesion molecule expression, enhances neutrophil chemotaxis, reduces burn...
Post Categories Uncategorized Post dateFebruary 28, 2024Post last updated dateUpdated February 28, 2024 Ells treated with recombinant VACVs was analyzed (Table two). We identified that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ells treated with recombinant VACVs was analyzed (Table 2). We identified that the cell...
Post Categories Uncategorized Post dateFebruary 28, 2024Post last updated dateUpdated February 28, 2024 Thin 5 years and as much as 40 within ten years when compared with 20 years in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Thin five years and as much as 40 inside 10 years in comparison with...
Post Categories Uncategorized Post dateFebruary 6, 2024Post last updated dateUpdated February 6, 2024 Patient security along with the advancement of Precision Medicine. This new study Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Patient security and also the advancement of Precision Medicine. This new study attempts to...
Post Categories Uncategorized Post dateFebruary 6, 2024Post last updated dateUpdated February 6, 2024 Ct free-standing LbL films.Supplies 2013, six Figure 1. Chemical structure of poly(diallylamine-co-maleic Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ct free-standing LbL films.Materials 2013, six Figure 1. Chemical structure of poly(diallylamine-co-maleic acid) (PDAMA).CHCHH2...
Post Categories Uncategorized Post dateFebruary 2, 2024Post last updated dateUpdated February 2, 2024 D blood cells within the urine. When visible it is termed Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D blood cells in the urine. When visible it is actually termed gross hematuria...
Post Categories Uncategorized Post dateFebruary 2, 2024Post last updated dateUpdated February 2, 2024 E with enhanced abiotic stress tolerance [59, 60]. The ONAC095-SRDX plants contained Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E with enhanced abiotic anxiety tolerance . The ONAC095-SRDX plants contained an elevated...
Post Categories Uncategorized Post dateJanuary 31, 2024Post last updated dateUpdated January 31, 2024 Ere followed for 2 years to study the biological causes and functional Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ere followed for two years to study the biological causes and functional consequences of...
Post Categories Uncategorized Post dateJanuary 31, 2024Post last updated dateUpdated January 31, 2024 Act as an efficient inflammasome inducer just after their injection into mice. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Act as an effective inflammasome inducer soon after their injection into mice. We injected...
Post Categories Uncategorized Post dateJanuary 30, 2024Post last updated dateUpdated January 30, 2024 Ous hemorrhage might have a number of etiologies, but manifest and occult trauma Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ous hemorrhage may have various etiologies, but manifest and occult trauma is most common....
Post Categories Uncategorized Post dateJanuary 30, 2024Post last updated dateUpdated January 30, 2024 SIRT1 protein and cytokines have been detected. All of the operations of transfection Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read SIRT1 protein and cytokines have been detected. Each of the operations of transfection have...
Post Categories Uncategorized Post dateJanuary 26, 2024Post last updated dateUpdated January 26, 2024 Iating the self-association with the lysozyme variants into oligomeric species and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Iating the self-association in the lysozyme variants into oligomeric species and subsequently into amyloid...
Post Categories Uncategorized Post dateJanuary 25, 2024Post last updated dateUpdated January 25, 2024 HCL-v situations showed simultaneous expression of CD5 and CD23. All 9 SMZL Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read HCL-v circumstances showed simultaneous expression of CD5 and CD23. All 9 SMZL cases showed...
Post Categories Uncategorized Post dateJanuary 25, 2024Post last updated dateUpdated January 25, 2024 Chlorinated biphenyls (PCBs) are within a category of persistent organic pollutants Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Chlorinated biphenyls (PCBs) are within a category of persistent organic pollutants (POPs) which can...
Post Categories Uncategorized Post dateJanuary 24, 2024Post last updated dateUpdated January 24, 2024 Events (AEs) have been monitored throughout the study. Benefits: All enrolled patients Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Events (AEs) were monitored throughout the study. Outcomes: All enrolled sufferers had been integrated...
Post Categories Uncategorized Post dateJanuary 24, 2024Post last updated dateUpdated January 24, 2024 Testing and an alpha of 0.05 was made use of. A log-rank Mantel-Cox test Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Testing and an alpha of 0.05 was utilised. A log-rank Mantel-Cox test was applied...
Post Categories Uncategorized Post dateJanuary 23, 2024Post last updated dateUpdated January 23, 2024 Rhinitis, and groups C (n = ten, asthma/rotatory handle) and D (n Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rhinitis, and groups C (n = ten, asthma/rotatory manage) and D (n = ten,...
Post Categories Uncategorized Post dateJanuary 23, 2024Post last updated dateUpdated January 23, 2024 To block autophagic flux. Next, dual therapy with CQ and WA Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read To block autophagic flux. Next, dual remedy with CQ and WA plus rapamycin, which...
Post Categories Uncategorized Post dateJanuary 22, 2024Post last updated dateUpdated January 22, 2024 Formation in substituted the bands in 832 cm of =O groups and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Formation in substituted the bands in 832 cm of =O groups along with the...
Post Categories Uncategorized Post dateJanuary 22, 2024Post last updated dateUpdated January 22, 2024 Hemical profile of your animal groups is shown in Table 1. Mice Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hemical profile of your animal groups is shown in Table 1. Mice fed an...
Post Categories Uncategorized Post dateJanuary 18, 2024Post last updated dateUpdated January 18, 2024 Of CD in nanomaterials can be applied to impart higher DTX Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Of CD in nanomaterials could be used to impart high DTX loading capabilities (Zhao...
Post Categories Uncategorized Post dateJanuary 18, 2024Post last updated dateUpdated January 18, 2024 G beads had been applied in anti-ER or anti–tubulin antibodies. An anti-rabbit Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read G beads had been used in anti-ER or anti–tubulin antibodies. An anti-rabbit IgG beads...
Post Categories Uncategorized Post dateJanuary 18, 2024Post last updated dateUpdated January 18, 2024 2 (three) (four)In all four circumstances, the negative Gibbs energy of reaction values Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read two (three) (4)In all four circumstances, the damaging Gibbs power of reaction values indicate...
Post Categories Uncategorized Post dateJanuary 18, 2024Post last updated dateUpdated January 18, 2024 Se re existence.Commented [AC2R1]: I rep one particular, just cropped Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Se re existence.Commented : I rep one, just cropped and locked caption is cut-off...
Post Categories Uncategorized Post dateJanuary 17, 2024Post last updated dateUpdated January 17, 2024 Equally blocked by either CB1 antagonist AM251 or CB2 antagonist SREqually blocked by either CB1 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Equally blocked by either CB1 antagonist AM251 or CB2 antagonist SREqually blocked by either...
Post Categories Uncategorized Post dateJanuary 17, 2024Post last updated dateUpdated January 17, 2024 0.05). Regression analysis showed that SGR, FI, FE and PER quadratically responded Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 0.05). Regression analysis showed that SGR, FI, FE and PER quadratically responded to improved...
Post Categories Uncategorized Post dateJanuary 17, 2024Post last updated dateUpdated January 17, 2024 Twelve production fluid samples and each of the cloned sequences had been affiliated Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Twelve production fluid samples and each of the cloned sequences had been affiliated with...
Post Categories Uncategorized Post dateJanuary 17, 2024Post last updated dateUpdated January 17, 2024 H information point ( D). 1 Statistically important difference (P 0.005) involving the plasma Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read H data point ( D). 1 Statistically important difference (P 0.005) between the plasma...
Post Categories Uncategorized Post dateJanuary 17, 2024Post last updated dateUpdated January 17, 2024 Ation of immunosuppression drugs, including Cyclophosphamide (CY), a chemotherapeutic agent that Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ation of immunosuppression drugs, which includes Cyclophosphamide (CY), a chemotherapeutic agent that exhibits a...
Post Categories Uncategorized Post dateJanuary 16, 2024Post last updated dateUpdated January 16, 2024 Activity against the RET kinase; nevertheless, no selective RET inhibitors have Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Activity against the RET kinase; on the other hand, no selective RET inhibitors have...
Post Categories Uncategorized Post dateJanuary 16, 2024Post last updated dateUpdated January 16, 2024 Dicated that the overall DCR was 27 (95 CI: 130 ) along with the median PFS Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Dicated that the general DCR was 27 (95 CI: 130 ) plus the median...
Post Categories Uncategorized Post dateJanuary 16, 2024Post last updated dateUpdated January 16, 2024 The Chinese Ministry of Overall health Grant (No. 2013ZX10003006). Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read International Journal ofEnvironmental The Chinese Ministry of Health Grant (No. 2013ZX10003006). International Journal ofEnvironmental...
Post Categories Uncategorized Post dateJanuary 16, 2024Post last updated dateUpdated January 16, 2024 E body of proof exists demonstrating that n-3 PUFAs can evoke Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E body of proof exists demonstrating that n-3 PUFAs can evoke endotheliumdependent NO-mediated relaxation....
Post Categories Uncategorized Post dateJanuary 15, 2024Post last updated dateUpdated January 15, 2024 St graft survival (18.0 years) and greatest overall survival (23.two years) and most Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read St graft survival (18.0 years) and greatest all round survival (23.two years) and most...
Post Categories Uncategorized Post dateJanuary 14, 2024Post last updated dateUpdated January 14, 2024 Articles have been 800 nm. As a result, SN-38/NCs-A showed the most beneficial tumor accumulation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Articles have been 800 nm. Therefore, SN-38/NCs-A showed the ideal tumor accumulation among the...
Post Categories Uncategorized Post dateJanuary 13, 2024Post last updated dateUpdated January 13, 2024 Giterm=RefSeq) and from expressed sequence tag (EST) contigs (://phrap.org Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Giterm=RefSeq) and from expressed sequence tag (EST) contigs (://phrap.org/green_group/est_assembly/human/ gene_number_methods.html). Every mRNA or EST...
Post Categories Uncategorized Post dateJanuary 12, 2024Post last updated dateUpdated January 12, 2024 4] such as Myc . Guidelines advise a strict surveillance protocol [5] in APC Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 4] like Myc . Suggestions advise a strict surveillance protocol in APC ,...
Post Categories Uncategorized Post dateJanuary 12, 2024Post last updated dateUpdated January 12, 2024 , and enhanced travel distances. Curcumin remarkably elevated platform crossing number and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read , and increased travel distances. Curcumin remarkably enhanced platform crossing quantity and time spent...
Post Categories Uncategorized Post dateJanuary 12, 2024Post last updated dateUpdated January 12, 2024 2, P2Y4, and P2Y6 requires activation of calcium-related pathways, at some point Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 2, P2Y4, and P2Y6 requires activation of calcium-related pathways, at some point leading to...
Post Categories Uncategorized Post dateJanuary 11, 2024Post last updated dateUpdated January 11, 2024 Y of illnesses, age distribution of population, geographic spread and availability Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Y of illnesses, age distribution of population, geographic spread and availability ofTable three. Prime...
Post Categories Uncategorized Post dateDecember 30, 2023Post last updated dateUpdated December 30, 2023 Rior to FOLFIRI in individuals previously treated with oxaliplatin-based chemotherapy,[9] theRior to FOLFIRI in sufferers Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rior to FOLFIRI in individuals previously treated with oxaliplatin-based chemotherapy, theRior to FOLFIRI in...
Post Categories Uncategorized Post dateDecember 29, 2023Post last updated dateUpdated December 29, 2023 S had been produced.ORIGINAL RESEARCHInsight and Remedy Outcomes in Schizophrenia: Post-hocS were produced.ORIGINAL RESEARCHInsight and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S had been produced.ORIGINAL RESEARCHInsight and Remedy Outcomes in Schizophrenia: Post-hocS were produced.ORIGINAL RESEARCHInsight...
Post Categories Uncategorized Post dateDecember 29, 2023Post last updated dateUpdated December 29, 2023 R for Itr1 gene, qIcy2-F and qIcy2-R for IcyR for Itr1 gene, qIcy2-F and qIcy2-R Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read R for Itr1 gene, qIcy2-F and qIcy2-R for IcyR for Itr1 gene, qIcy2-F and...
Post Categories Uncategorized Post dateDecember 28, 2023Post last updated dateUpdated December 28, 2023 N at 4 . The Cathepsin B Protein Storage & Stability sedimented mitochondrial pellet was Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N at 4 . The Cathepsin B Protein Storage & Stability sedimented mitochondrial pellet...
Post Categories Uncategorized Post dateDecember 28, 2023Post last updated dateUpdated December 28, 2023 Genome to make bait-IL-6R alpha Protein MedChemExpress reporter strains. A cDNA library was constructed fromGenome Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Genome to make bait-IL-6R alpha Protein MedChemExpress reporter strains. A cDNA library was constructed...
Post Categories Uncategorized Post dateDecember 28, 2023Post last updated dateUpdated December 28, 2023 The pH of TPP affects the electronegative potential on the moleculeThe pH of TPP affects Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The pH of TPP affects the electronegative potential on the moleculeThe pH of TPP...
Post Categories Uncategorized Post dateDecember 28, 2023Post last updated dateUpdated December 28, 2023 L phased-arrayed head coil. All participants were verbally instructed to stayL phased-arrayed head coil. All Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read L phased-arrayed head coil. All participants were verbally instructed to stayL phased-arrayed head coil....
Post Categories Uncategorized Post dateDecember 28, 2023Post last updated dateUpdated December 28, 2023 Articles were 800 nm. Thus, SN-38/NCs-A IL-4, Human showed the most effective tumor accumulationArticles have Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Articles were 800 nm. Thus, SN-38/NCs-A IL-4, Human showed the most effective tumor accumulationArticles...
Post Categories Uncategorized Post dateDecember 27, 2023Post last updated dateUpdated December 27, 2023 PASK IBA 3+ (IBA Streptavidin Magnetic Beads custom synthesis Lifesciences), pFRED143 (Ludwig et al., 1999); Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read PASK IBA 3+ (IBA Streptavidin Magnetic Beads custom synthesis Lifesciences), pFRED143 (Ludwig et al.,...
Post Categories Uncategorized Post dateDecember 27, 2023Post last updated dateUpdated December 27, 2023 Cations of individuals undergoing operations (1). Despite many researches and availability ofCations of individuals undergoing Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Cations of individuals undergoing operations (1). Despite many researches and availability ofCations of individuals...
Post Categories Uncategorized Post dateDecember 27, 2023Post last updated dateUpdated December 27, 2023 As shown across species.18,23,24,79 The most prominent phenotype in pls3 KOAs shown across species.18,23,24,79 Probably Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read As shown across species.18,23,24,79 The most prominent phenotype in pls3 KOAs shown across species.18,23,24,79...
Post Categories Uncategorized Post dateDecember 27, 2023Post last updated dateUpdated December 27, 2023 Gd-IgA1 than do the cells from HCs, concordantly with the serumGd-IgA1 than do the cells Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Gd-IgA1 than do the cells from HCs, concordantly with the serumGd-IgA1 than do the...
Post Categories Uncategorized Post dateDecember 26, 2023Post last updated dateUpdated December 26, 2023 Aling from human Serum Albumin/ALB Protein site breast cancer cells. Morin and MST-312 therapy inhibitedAling Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Aling from human Serum Albumin/ALB Protein site breast cancer cells. Morin and MST-312 therapy...
Post Categories Uncategorized Post dateDecember 26, 2023Post last updated dateUpdated December 26, 2023 Mice. Values are imply D and are normalized with respect toMice. Values are imply Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Mice. Values are imply D and are normalized with respect toMice. Values are imply...
Post Categories Uncategorized Post dateDecember 26, 2023Post last updated dateUpdated December 26, 2023 Bsorption of Cy5 at 280 nm (0.05 sirtuininhibitorCy5 absorption at 650 nm), and byBsorption of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Bsorption of Cy5 at 280 nm (0.05 sirtuininhibitorCy5 absorption at 650 nm), and byBsorption...
Post Categories Uncategorized Post dateDecember 26, 2023Post last updated dateUpdated December 26, 2023 0.five M urea, 300 mM IgG4 Fc Protein Formulation imidazole, 0.1 rapigest (or Nonidet Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read 0.five M urea, 300 mM IgG4 Fc Protein Formulation imidazole, 0.1 rapigest (or Nonidet...
Post Categories Uncategorized Post dateDecember 26, 2023Post last updated dateUpdated December 26, 2023 . Enzyme histochemistry permitted to localize trypsin-like enzymes in T. absoluta L. Enzyme histochemistry permitted Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read . Enzyme histochemistry permitted to localize trypsin-like enzymes in T. absoluta L. Enzyme histochemistry...
Post Categories Uncategorized Post dateDecember 25, 2023Post last updated dateUpdated December 25, 2023 Partial response; SD, steady disease; PD, progressive illness; PS, performance status.Partial response; SD, stable illness; Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Partial response; SD, steady disease; PD, progressive illness; PS, performance status.Partial response; SD, stable...
Post Categories Uncategorized Post dateDecember 25, 2023Post last updated dateUpdated December 25, 2023 Itor12.two years and 80 had been female, 60 Caucasian, and 60 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Itor12.two years and 80 had been female, 60 Caucasian, and 60 Scl-70 constructive. Duration...
Post Categories Uncategorized Post dateDecember 25, 2023Post last updated dateUpdated December 25, 2023 Ofrontal cortex/mPFC (BA 11/10) Suitable FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Proper Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ofrontal cortex/mPFC (BA 11/10) Suitable FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Post Categories Uncategorized Post dateDecember 25, 2023Post last updated dateUpdated December 25, 2023 Containing EDTA-2Na (15 mL/kg), followed by centrifugation at 1000 g atContaining EDTA-2Na (15 mL/kg), followed Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Containing EDTA-2Na (15 mL/kg), followed by centrifugation at 1000 g atContaining EDTA-2Na (15 mL/kg),...
Post Categories Uncategorized Post dateDecember 25, 2023Post last updated dateUpdated December 25, 2023 NaCl, 100 mM sodium acetate (pH 5.5) containing 1 mg/ml pronase, and 1 mgNaCl, one Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read NaCl, 100 mM sodium acetate (pH 5.5) containing 1 mg/ml pronase, and 1 mgNaCl,...
Post Categories Uncategorized Post dateDecember 21, 2023Post last updated dateUpdated December 21, 2023 YFIGURE 2. Gut function is improved in Tg mice given oral FTYYFIGURE two. Gut function Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read YFIGURE 2. Gut function is improved in Tg mice given oral FTYYFIGURE two. Gut...
Post Categories Uncategorized Post dateDecember 21, 2023Post last updated dateUpdated December 21, 2023 Ent NCDs/chronic illnesses.4. Frequent Outcomes of DIT and Risk ofEnt NCDs/chronic illnesses.four. Frequent Outcomes of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ent NCDs/chronic illnesses.4. Frequent Outcomes of DIT and Risk ofEnt NCDs/chronic illnesses.four. Frequent Outcomes...
Post Categories Uncategorized Post dateDecember 21, 2023Post last updated dateUpdated December 21, 2023 _F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R: Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read _F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC,...
Post Categories Uncategorized Post dateDecember 21, 2023Post last updated dateUpdated December 21, 2023 Tor experiments indicating the involvement of p38 but not JAK2 inTor experiments indicating the involvement Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tor experiments indicating the involvement of p38 but not JAK2 inTor experiments indicating the...
Post Categories Uncategorized Post dateDecember 20, 2023Post last updated dateUpdated December 20, 2023 Angerhans cells are skin-resident immune cells that associate closely with keratinocytesAngerhans cells are skin-resident immune Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Angerhans cells are skin-resident immune cells that associate closely with keratinocytesAngerhans cells are skin-resident...
Post Categories Uncategorized Post dateDecember 20, 2023Post last updated dateUpdated December 20, 2023 Lthough an undetectable viral level at week 4 or 12 is actually a excellentLthough an Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Lthough an undetectable viral level at week 4 or 12 is actually a excellentLthough...
Post Categories Uncategorized Post dateDecember 20, 2023Post last updated dateUpdated December 20, 2023 Lar obligate pathogenic bacteria with similar developmental cycle and cell biologyLar obligate pathogenic bacteria with Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Lar obligate pathogenic bacteria with similar developmental cycle and cell biologyLar obligate pathogenic bacteria...
Post Categories Uncategorized Post dateDecember 20, 2023Post last updated dateUpdated December 20, 2023 Oral gyrus is situated amongst the anterior and posterior lateral portionOral gyrus is positioned between Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Oral gyrus is situated amongst the anterior and posterior lateral portionOral gyrus is positioned...
Post Categories Uncategorized Post dateDecember 20, 2023Post last updated dateUpdated December 20, 2023 Ly distinct (P0.05). There have been some probable explanations for these benefits.Ly distinct (P0.05). There Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ly distinct (P0.05). There have been some probable explanations for these benefits.Ly distinct (P0.05)....
Post Categories Uncategorized Post dateDecember 19, 2023Post last updated dateUpdated December 19, 2023 Olitinib but not Tofacinitib DKK-3 Protein site decreased ALDH+ lung cancer cells indicating theOlitinib but Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Olitinib but not Tofacinitib DKK-3 Protein site decreased ALDH+ lung cancer cells indicating theOlitinib...
Post Categories Uncategorized Post dateDecember 19, 2023Post last updated dateUpdated December 19, 2023 Ve explored the link involving childhood Cadherin-11, Human (HEK293, His) trauma exposure, cancer remedy, dysregulationVe Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ve explored the link involving childhood Cadherin-11, Human (HEK293, His) trauma exposure, cancer remedy,...
Post Categories Uncategorized Post dateDecember 19, 2023Post last updated dateUpdated December 19, 2023 Toxins and citrinin are mycotoxins made by fungi developing on uniqueToxins and citrinin are mycotoxins Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Toxins and citrinin are mycotoxins made by fungi developing on uniqueToxins and citrinin are...
Post Categories Uncategorized Post dateDecember 19, 2023Post last updated dateUpdated December 19, 2023 N. Particularly, when categorized by MSKCC criteria,13 intermediate- and poor-risk patientsN. Especially, when categorized by Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N. Particularly, when categorized by MSKCC criteria,13 intermediate- and poor-risk patientsN. Especially, when categorized...
Post Categories Uncategorized Post dateDecember 18, 2023Post last updated dateUpdated December 18, 2023 S in TF and TFRC genes in between analyzed groups of individuals.S in TF and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S in TF and TFRC genes in between analyzed groups of individuals.S in TF...
Post Categories Uncategorized Post dateDecember 18, 2023Post last updated dateUpdated December 18, 2023 Revisiae prions. Very first, overexpression of Ctr4 as an YFP fusion resultedRevisiae prions. First, overexpression Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Revisiae prions. Very first, overexpression of Ctr4 as an YFP fusion resultedRevisiae prions. First,...
Post Categories Uncategorized Post dateDecember 18, 2023Post last updated dateUpdated December 18, 2023 Ra certain for SAD1 (16) failed to detect cross-reacting protein in proteinRa distinct for SAD1 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ra certain for SAD1 (16) failed to detect cross-reacting protein in proteinRa distinct for...
Post Categories Uncategorized Post dateDecember 18, 2023Post last updated dateUpdated December 18, 2023 Ence of three M UMP. The activity of your enzymes present inEnce of 3 M Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ence of three M UMP. The activity of your enzymes present inEnce of 3...
Post Categories Uncategorized Post dateDecember 18, 2023Post last updated dateUpdated December 18, 2023 At roughly equal proportions beneath basal culture situations (31). Also toAt about equal proportions beneath Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read At roughly equal proportions beneath basal culture situations (31). Also toAt about equal proportions...
Post Categories Uncategorized Post dateDecember 17, 2023Post last updated dateUpdated December 17, 2023 G molecules in dM or uM, cells were permeabilized (Cytofix/CytopermG molecules in dM or uM, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read G molecules in dM or uM, cells were permeabilized (Cytofix/CytopermG molecules in dM or...
Post Categories Uncategorized Post dateDecember 16, 2023Post last updated dateUpdated December 16, 2023 N. Nat Cell Biol. 2012;14(12):1282sirtuininhibitor4. 57. Kong LN, Zuo PP, Mu LN. Nat Cell Biol. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N. Nat Cell Biol. 2012;14(12):1282sirtuininhibitor4. 57. Kong LN, Zuo PP, Mu LN. Nat Cell...
Post Categories Uncategorized Post dateDecember 15, 2023Post last updated dateUpdated December 15, 2023 H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Sade, G.H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Sade, G.H.S.; Fuchs, K.; Sullivan, L.; Comstock,...
Post Categories Uncategorized Post dateDecember 15, 2023Post last updated dateUpdated December 15, 2023 Ofrontal cortex/mPFC (BA 11/10) Proper FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Correct Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ofrontal cortex/mPFC (BA 11/10) Proper FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Post Categories Uncategorized Post dateDecember 15, 2023Post last updated dateUpdated December 15, 2023 Articles had been 800 nm. Therefore, SN-38/NCs-A showed the most effective tumor accumulationArticles had been Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Articles had been 800 nm. Therefore, SN-38/NCs-A showed the most effective tumor accumulationArticles had...
Post Categories Uncategorized Post dateDecember 14, 2023Post last updated dateUpdated December 14, 2023 ) was heated to 70 below Ar2 for 18 h. Just after cooling Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read ) was heated to 70 below Ar2 for 18 h. Just after cooling to...
Post Categories Uncategorized Post dateDecember 14, 2023Post last updated dateUpdated December 14, 2023 Cantly in B6.TNF-/- mice over the course of illnessCantly in B6.TNF-/- mice over the course Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Cantly in B6.TNF-/- mice over the course of illnessCantly in B6.TNF-/- mice over the...
Post Categories Uncategorized Post dateDecember 14, 2023Post last updated dateUpdated December 14, 2023 Ponse towards the GFD; (2) measuring the effect of reintroducing gluten followingPonse for the GFD; Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ponse towards the GFD; (2) measuring the effect of reintroducing gluten followingPonse for the...
Post Categories Uncategorized Post dateDecember 14, 2023Post last updated dateUpdated December 14, 2023 Ofrontal cortex/mPFC (BA 11/10) Right FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Suitable Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ofrontal cortex/mPFC (BA 11/10) Right FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Post Categories Uncategorized Post dateDecember 14, 2023Post last updated dateUpdated December 14, 2023 Neously with 1 106 BE (2)-c cells followed by instant therapy with 5000 mgNeously with Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Neously with 1 106 BE (2)-c cells followed by instant therapy with 5000 mgNeously...
Post Categories Uncategorized Post dateDecember 12, 2023Post last updated dateUpdated December 12, 2023 Y was detected only in one particular pregnancy with pre-eclampsia and fetalY was detected only Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Y was detected only in one particular pregnancy with pre-eclampsia and fetalY was detected...
Post Categories Uncategorized Post dateDecember 12, 2023Post last updated dateUpdated December 12, 2023 At mimics the GTP-bound state in the protein (GTR1-Q65L) increases TORC1 activity during amino acid Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read At mimics the GTP-bound state in the protein (GTR1-Q65L) increases TORC1 activity during amino...
Post Categories Uncategorized Post dateDecember 12, 2023Post last updated dateUpdated December 12, 2023 Was observed in subpopulation of renal medullary cells which can be arrangedWas observed in subpopulation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Was observed in subpopulation of renal medullary cells which can be arrangedWas observed in...
Post Categories Uncategorized Post dateDecember 12, 2023Post last updated dateUpdated December 12, 2023 Rectly and consequently stay prone to suffer from skinning injury more thanRectly and consequently stay Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rectly and consequently stay prone to suffer from skinning injury more thanRectly and consequently...
Post Categories Uncategorized Post dateDecember 11, 2023Post last updated dateUpdated December 11, 2023 Is positioned downstream of H2 O2 to mediate H2 O2 -induced sarcKATP channel stimulation in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Is positioned downstream of H2 O2 to mediate H2 O2 -induced sarcKATP channel stimulation...
Post Categories Uncategorized Post dateDecember 11, 2023Post last updated dateUpdated December 11, 2023 Ere obtainable for the deceased kids. Genetic testing also identified the exact same mutation in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ere obtainable for the deceased kids. Genetic testing also identified the exact same mutation...
Post Categories Uncategorized Post dateDecember 11, 2023Post last updated dateUpdated December 11, 2023 E 1A) was adapted from previous work5,28. The chip was laser cut from acrylic sheets Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E 1A) was adapted from previous work5,28. The chip was laser cut from acrylic...
Post Categories Uncategorized Post dateDecember 11, 2023Post last updated dateUpdated December 11, 2023 Fter treatment of LPS-stimulated macrophages with the drug I-BET (40), expression ofFter remedy of LPS-stimulated Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Fter treatment of LPS-stimulated macrophages with the drug I-BET (40), expression ofFter remedy of...
Post Categories Uncategorized Post dateDecember 11, 2023Post last updated dateUpdated December 11, 2023 Al., 2013). However, muscle- or liver-specific deletion of SIRT3 GDF-11/BMP-11, Human (HEK293) didn't resultAl., 2013). Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Al., 2013). However, muscle- or liver-specific deletion of SIRT3 GDF-11/BMP-11, Human (HEK293) didn’t resultAl.,...
Post Categories Uncategorized Post dateDecember 8, 2023Post last updated dateUpdated December 8, 2023 Altered, indicating the AITRL/TNFSF18 Trimer Protein Source presence of oxidative tension [18]. This effect was Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Altered, indicating the AITRL/TNFSF18 Trimer Protein Source presence of oxidative tension . This effect...
Post Categories Uncategorized Post dateDecember 8, 2023Post last updated dateUpdated December 8, 2023 Ctious Diseases, 2011, 204 Suppl three;S757?60. doi:10.1093/infdis/ jir296 pmid:21987747 35. Pan Y et al. Reston Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ctious Diseases, 2011, 204 Suppl three;S757?60. doi:10.1093/infdis/ jir296 pmid:21987747 35. Pan Y et al....
Post Categories Uncategorized Post dateDecember 8, 2023Post last updated dateUpdated December 8, 2023 Al cells [6]. This finding suggests that ECyd causes Vaults dysfunction preferentiallyAl cells [6]. This Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Al cells . This finding suggests that ECyd causes Vaults dysfunction preferentiallyAl cells ....
Post Categories Uncategorized Post dateDecember 8, 2023Post last updated dateUpdated December 8, 2023 Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by...
Post Categories Uncategorized Post dateDecember 7, 2023Post last updated dateUpdated December 7, 2023 Xpression didn't exhibit a important effect on all round survival (data not shown). To validate Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Xpression didn’t exhibit a important effect on all round survival (data not shown). To...
Post Categories Uncategorized Post dateDecember 7, 2023Post last updated dateUpdated December 7, 2023 Ncovered an inverse connection between the frequency of syntillas and amperometric ACTB Protein web events Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ncovered an inverse connection between the frequency of syntillas and amperometric ACTB Protein web...
Post Categories Uncategorized Post dateDecember 7, 2023Post last updated dateUpdated December 7, 2023 Ors may perhaps TGF beta 2/TGFB2 Protein site present novel signifies for the remedy of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ors may perhaps TGF beta 2/TGFB2 Protein site present novel signifies for the remedy...
Post Categories Uncategorized Post dateDecember 7, 2023Post last updated dateUpdated December 7, 2023 Ever making use of sugammadex in their everyday practice. Occasional use of sugammadexEver employing sugammadex Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ever making use of sugammadex in their everyday practice. Occasional use of sugammadexEver employing...
Post Categories Uncategorized Post dateDecember 7, 2023Post last updated dateUpdated December 7, 2023 Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes....
Post Categories Uncategorized Post dateDecember 6, 2023Post last updated dateUpdated December 6, 2023 Is hydrogen bonded to water molecules by way of the ester and carboxy moieties, forming Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Is hydrogen bonded to water molecules by way of the ester and carboxy moieties,...
Post Categories Uncategorized Post dateDecember 6, 2023Post last updated dateUpdated December 6, 2023 Ive instances with water and subjected to TFA hydrolysis (two M final concentration) for three Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ive instances with water and subjected to TFA hydrolysis (two M final concentration) for...
Post Categories Uncategorized Post dateDecember 6, 2023Post last updated dateUpdated December 6, 2023 Maturity. Bar=50 m. (C) SEM picture of mature OsAP65+/+ pollen grains. Bar=50 m. (D) A Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Maturity. Bar=50 m. (C) SEM picture of mature OsAP65+/+ pollen grains. Bar=50 m. (D)...
Post Categories Uncategorized Post dateDecember 6, 2023Post last updated dateUpdated December 6, 2023 Of inner sequence positions, they call for changes of standard RNA synthesisOf internal sequence positions, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Of inner sequence positions, they call for changes of standard RNA synthesisOf internal sequence...
Post Categories Uncategorized Post dateDecember 4, 2023Post last updated dateUpdated December 4, 2023 Y with the residue as a criterion and enhanced its performance. Having said that, so Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Y with the residue as a criterion and enhanced its performance. Having said that,...
Post Categories Uncategorized Post dateDecember 4, 2023Post last updated dateUpdated December 4, 2023 Vs glargine (n = 159) plus metformin (each arms) FBG: 8.1 vs 6.5 mmol/L (P Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Vs glargine (n = 159) plus metformin (each arms) FBG: 8.1 vs 6.5 mmol/L...
Post Categories Uncategorized Post dateDecember 4, 2023Post last updated dateUpdated December 4, 2023 Ncubated with Alexa Fluor?488 fluorochrome-conjugated secondary antibody (Invitrogen, USA) in PBS, and had been then Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ncubated with Alexa Fluor?488 fluorochrome-conjugated secondary antibody (Invitrogen, USA) in PBS, and had been...
Post Categories Uncategorized Post dateDecember 4, 2023Post last updated dateUpdated December 4, 2023 Es relies on seemingly telomerespecific molecular pathways. Nevertheless, it appears thatEs relies on seemingly telomerespecific Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Es relies on seemingly telomerespecific molecular pathways. Nevertheless, it appears thatEs relies on seemingly...
Post Categories Uncategorized Post dateDecember 4, 2023Post last updated dateUpdated December 4, 2023 Ain promoter activities in the root-hair zone. A strong and veryAin promoter activities in the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ain promoter activities in the root-hair zone. A strong and veryAin promoter activities in...
Post Categories Uncategorized Post dateDecember 1, 2023Post last updated dateUpdated December 1, 2023 Em for three min, which was confirmed to be adequate for equilibration. The data are Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Em for three min, which was confirmed to be adequate for equilibration. The data...
Post Categories Uncategorized Post dateDecember 1, 2023Post last updated dateUpdated December 1, 2023 Anosine pentaphosphate (pppGpp), accumulate beneath starvation circumstances (Chatterji and Ojha, 2001). On the one hand Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Anosine pentaphosphate (pppGpp), accumulate beneath starvation circumstances (Chatterji and Ojha, 2001). On the one...
Post Categories Uncategorized Post dateDecember 1, 2023Post last updated dateUpdated December 1, 2023 Ovide additional information about the underlying causes of connected ailments, for example Hirschsprung's and OIBD1,14,17. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ovide additional information about the underlying causes of connected ailments, for example Hirschsprung’s and...
Post Categories Uncategorized Post dateDecember 1, 2023Post last updated dateUpdated December 1, 2023 Copoeia, System II, a paddle strategy, was performed making use of a RCZ-Copoeia, Approach II, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Copoeia, System II, a paddle strategy, was performed making use of a RCZ-Copoeia, Approach...
Post Categories Uncategorized Post dateDecember 1, 2023Post last updated dateUpdated December 1, 2023 Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes....
Post Categories Uncategorized Post dateNovember 30, 2023Post last updated dateUpdated November 30, 2023 Overexpressing cells. Fluorescence was excited employing the 488 nm line of the argon laser and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Overexpressing cells. Fluorescence was excited employing the 488 nm line of the argon laser...
Post Categories Uncategorized Post dateNovember 30, 2023Post last updated dateUpdated November 30, 2023 Ing aspect for AF. A Danish cohort study supports the observation in the Japanese study; Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ing aspect for AF. A Danish cohort study supports the observation in the Japanese...
Post Categories Uncategorized Post dateNovember 30, 2023Post last updated dateUpdated November 30, 2023 Ls. Discontinuations due to AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations because of AEs Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ls. Discontinuations due to AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations because of...
Post Categories Uncategorized Post dateNovember 30, 2023Post last updated dateUpdated November 30, 2023 Expression of its coding counterpart, AFAP1. Precise Inhibition of AFAP1-ASExpression of its coding counterpart, AFAP1. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Expression of its coding counterpart, AFAP1. Precise Inhibition of AFAP1-ASExpression of its coding counterpart,...
Post Categories Uncategorized Post dateNovember 29, 2023Post last updated dateUpdated November 29, 2023 Unctate staining was also visible in type II alveolar epithelial cells (figure 3E, F).DISCUSSION To Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Unctate staining was also visible in type II alveolar epithelial cells (figure 3E, F).DISCUSSION...
Post Categories Uncategorized Post dateNovember 29, 2023Post last updated dateUpdated November 29, 2023 Ied from an Iranian population had C-shaped canals. Inside a study of Rahimi et al. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ied from an Iranian population had C-shaped canals. Inside a study of Rahimi et...
Post Categories Uncategorized Post dateNovember 29, 2023Post last updated dateUpdated November 29, 2023 Ks post-infection. These benefits suggest a correlation among the lack of AQP4 and decreased generation Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ks post-infection. These benefits suggest a correlation among the lack of AQP4 and decreased...
Post Categories Uncategorized Post dateNovember 29, 2023Post last updated dateUpdated November 29, 2023 Copoeia, IFN-gamma Protein Species System II, a paddle strategy, was performed employing a RCZ-Copoeia, Technique Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Copoeia, IFN-gamma Protein Species System II, a paddle strategy, was performed employing a RCZ-Copoeia,...
Post Categories Uncategorized Post dateNovember 29, 2023Post last updated dateUpdated November 29, 2023 Wnt4 Protein MedChemExpress Sponding band images from the MEFs. MWAs. The cells were lysedSponding band Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Wnt4 Protein MedChemExpress Sponding band images from the MEFs. MWAs. The cells were lysedSponding...
Post Categories Uncategorized Post dateNovember 28, 2023Post last updated dateUpdated November 28, 2023 Immature granulocytes using the absence of granulocytic dysplasia, monocytosis, eosinophilia, and basophilia [1]. Further clinicopathologic Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Immature granulocytes using the absence of granulocytic dysplasia, monocytosis, eosinophilia, and basophilia . Further...
Post Categories Uncategorized Post dateNovember 28, 2023Post last updated dateUpdated November 28, 2023 Bust analogue of mean, and IQR is actually a robust measure of variability; functionals which Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Bust analogue of mean, and IQR is actually a robust measure of variability; functionals...
Post Categories Uncategorized Post dateNovember 28, 2023Post last updated dateUpdated November 28, 2023 ML) LDL-C5/HDL-C6 non-HDL-C/HDL-C 26.45 ?1.06 63.19 ?2.52 62.15 ?1.90 50.ten ?1.05 29.41 ?1.38 17.76 ?0.32 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read ML) LDL-C5/HDL-C6 non-HDL-C/HDL-C 26.45 ?1.06 63.19 ?2.52 62.15 ?1.90 50.ten ?1.05 29.41 ?1.38 17.76...
Post Categories Uncategorized Post dateNovember 28, 2023Post last updated dateUpdated November 28, 2023 The Ca2 source. We demonstrate that the time course for suchThe Ca2 supply. We demonstrate Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read The Ca2 source. We demonstrate that the time course for suchThe Ca2 supply. We...
Post Categories Uncategorized Post dateNovember 27, 2023Post last updated dateUpdated November 27, 2023 Channel modulators. J Biol Chem 275(47):36556?6561. 40. Durham WJ, et al. (2008) RyR1 S-nitrosylation underlies Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Channel modulators. J Biol Chem 275(47):36556?6561. 40. Durham WJ, et al. (2008) RyR1 S-nitrosylation...
Post Categories Uncategorized Post dateNovember 27, 2023Post last updated dateUpdated November 27, 2023 Hanges underlying 6OHDA-mediated dysfunction (Figure 6C). The present findings demonstrated that (1) 6-OHDA quickly mTORC1 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hanges underlying 6OHDA-mediated dysfunction (Figure 6C). The present findings demonstrated that (1) 6-OHDA quickly...
Post Categories Uncategorized Post dateNovember 27, 2023Post last updated dateUpdated November 27, 2023 He 900 mM TEA-Cl maintained the osmotic balance and chloride concentration across the bilayer though Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read He 900 mM TEA-Cl maintained the osmotic balance and chloride concentration across the bilayer...
Post Categories Uncategorized Post dateNovember 27, 2023Post last updated dateUpdated November 27, 2023 Nd 3 months following switching drugs. P 0.001, P = 0.006 in comparison with Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nd 3 months following switching drugs. P 0.001, P = 0.006 in comparison with...
Post Categories Uncategorized Post dateNovember 27, 2023Post last updated dateUpdated November 27, 2023 Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and escalatingOrmin activates AMPK by inhibiting Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and escalatingOrmin activates AMPK by...
Post Categories Uncategorized Post dateNovember 24, 2023Post last updated dateUpdated November 24, 2023 N Yua,b, Young Eun Hana,b, Young-Sun Jia,b, Keunhee Ohc, Jong-Woo Sohna, Ajin Lima, Jae-Pyo Jeonb, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N Yua,b, Young Eun Hana,b, Young-Sun Jia,b, Keunhee Ohc, Jong-Woo Sohna, Ajin Lima, Jae-Pyo...
Post Categories Uncategorized Post dateNovember 24, 2023Post last updated dateUpdated November 24, 2023 group2 substitutions from the combined group1234 substitutions (hSTINGgroup134) strongly diminished DMXAA activation, whereas loss of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read group2 substitutions from the combined group1234 substitutions (hSTINGgroup134) strongly diminished DMXAA activation, whereas loss...
Post Categories Uncategorized Post dateNovember 24, 2023Post last updated dateUpdated November 24, 2023 Localization (73). Interestingly, the deletion from the LI domain abolished IFNGR1 capping and redistributed IFNGR1 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Localization (73). Interestingly, the deletion from the LI domain abolished IFNGR1 capping and redistributed...
Post Categories Uncategorized Post dateNovember 24, 2023Post last updated dateUpdated November 24, 2023 Such because the beta cells on the pancreas) and non-self (this kind ofSuch as the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Such because the beta cells on the pancreas) and non-self (this kind ofSuch as...
Post Categories Uncategorized Post dateNovember 24, 2023Post last updated dateUpdated November 24, 2023 Ne hundred independent docking runs had been carried out for the disaccharide.Ne hundred independent docking Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ne hundred independent docking runs had been carried out for the disaccharide.Ne hundred independent...
Post Categories Uncategorized Post dateNovember 23, 2023Post last updated dateUpdated November 23, 2023 Accordance with the suggestions within the Guide for the Care and Use of Laboratory Animals Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Accordance with the suggestions within the Guide for the Care and Use of Laboratory...
Post Categories Uncategorized Post dateNovember 23, 2023Post last updated dateUpdated November 23, 2023 E hydroxylation within the heart, possible inhibitors using a documented history of cardiotoxicity have been Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E hydroxylation within the heart, possible inhibitors using a documented history of cardiotoxicity have...
Post Categories Uncategorized Post dateNovember 23, 2023Post last updated dateUpdated November 23, 2023 Nd/or decreased survival (Table 1) [63, 64, 66-69, 71-73]. New diagnostic methods are linking previously Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nd/or decreased survival (Table 1) . New diagnostic methods are linking...
Post Categories Uncategorized Post dateNovember 23, 2023Post last updated dateUpdated November 23, 2023 Of ICH had been unique involving the review groups. These benefits couldOf ICH were distinct Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Of ICH had been unique involving the review groups. These benefits couldOf ICH were...
Post Categories Uncategorized Post dateNovember 23, 2023Post last updated dateUpdated November 23, 2023 Rnatant was recentrifuged at 16,000 g for 15 min, and also the pellets have beenRnatant Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rnatant was recentrifuged at 16,000 g for 15 min, and also the pellets have...
Post Categories Uncategorized Post dateNovember 21, 2023Post last updated dateUpdated November 21, 2023 Actin, 1 l of cDNA template and the following specific primers had been made use Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Actin, 1 l of cDNA template and the following specific primers had been made...
Post Categories Uncategorized Post dateNovember 21, 2023Post last updated dateUpdated November 21, 2023 Any phenotypic alteration within the adipose tissue of Agtrap??mice below HF loading, and Agtrap??mice certainly Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Any phenotypic alteration within the adipose tissue of Agtrap??mice below HF loading, and Agtrap??mice...
Post Categories Uncategorized Post dateNovember 21, 2023Post last updated dateUpdated November 21, 2023 Ition of its metabolic end item calcium oxalate crystals in numerousItion of its metabolic end Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ition of its metabolic end item calcium oxalate crystals in numerousItion of its metabolic...
Post Categories Uncategorized Post dateNovember 21, 2023Post last updated dateUpdated November 21, 2023 Tic PME activity is itself post-translationally controlled by way of a 1 : 1 interaction Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tic PME activity is itself post-translationally controlled by way of a 1 : 1...
Post Categories Uncategorized Post dateNovember 20, 2023Post last updated dateUpdated November 20, 2023 Munol 2011; 187: 2181?192. 23 Kline JN, Cowden JD, Hunninghake GW, Schutte BC, Watt JL, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Munol 2011; 187: 2181?192. 23 Kline JN, Cowden JD, Hunninghake GW, Schutte BC, Watt...
Post Categories Uncategorized Post dateNovember 20, 2023Post last updated dateUpdated November 20, 2023 At 10 kHz (Molecular Devices). Liquid junction potentials were calculated from the Clampex built-in JPCalcW Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read At 10 kHz (Molecular Devices). Liquid junction potentials were calculated from the Clampex built-in...
Post Categories Uncategorized Post dateNovember 20, 2023Post last updated dateUpdated November 20, 2023 By environmental things, which includes siblings and care centers (15). The physical connection between the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read By environmental things, which includes siblings and care centers (15). The physical connection between...
Post Categories Uncategorized Post dateNovember 20, 2023Post last updated dateUpdated November 20, 2023 Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter therapy of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter therapy...
Post Categories Uncategorized Post dateNovember 20, 2023Post last updated dateUpdated November 20, 2023 Salvage pathway and hydroxykynurenine within the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Salvage pathway and hydroxykynurenine within the de novo pathway, of NADSalvage pathway and hydroxykynurenine...
Post Categories Uncategorized Post dateNovember 17, 2023Post last updated dateUpdated November 17, 2023 Pe?probe targeting BCAR4 was designed and synthesized by Advanced Cell Diagnostics and detection of BCAR4 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Pe?probe targeting BCAR4 was designed and synthesized by Advanced Cell Diagnostics and detection of...
Post Categories Uncategorized Post dateNovember 17, 2023Post last updated dateUpdated November 17, 2023 Ectra have been visualized employing Sparky (Goddard TD, Kneller DG, SPARKY3, University of California, San Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ectra have been visualized employing Sparky (Goddard TD, Kneller DG, SPARKY3, University of California,...
Post Categories Uncategorized Post dateNovember 17, 2023Post last updated dateUpdated November 17, 2023 N (Supplementary Fig. S4A at JXB on the web). To confirm that the male defect Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N (Supplementary Fig. S4A at JXB on the web). To confirm that the male...
Post Categories Uncategorized Post dateNovember 17, 2023Post last updated dateUpdated November 17, 2023 N by proteolytic enzymes,9 these improve cancer cell's capability forN by proteolytic enzymes,9 these boost Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N by proteolytic enzymes,9 these improve cancer cell’s capability forN by proteolytic enzymes,9 these...
Post Categories Uncategorized Post dateNovember 15, 2023Post last updated dateUpdated November 15, 2023 Approaches just usually do not have the capacity to home-in on small features on the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Approaches just usually do not have the capacity to home-in on small features on...
Post Categories Uncategorized Post dateNovember 15, 2023Post last updated dateUpdated November 15, 2023 Was consistent and much more than 60 . PK evaluation showed that TK900D and TK900E Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Was consistent and much more than 60 . PK evaluation showed that TK900D and...
Post Categories Uncategorized Post dateNovember 15, 2023Post last updated dateUpdated November 15, 2023 Cells may perhaps be FP Agonist review present in our cultures; nevertheless, further testing would Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Cells may perhaps be FP Agonist review present in our cultures; nevertheless, further testing...
Post Categories Uncategorized Post dateNovember 15, 2023Post last updated dateUpdated November 15, 2023 Ition of its metabolic finish product calcium oxalate crystals in variousItion of its metabolic end Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ition of its metabolic finish product calcium oxalate crystals in variousItion of its metabolic...
Post Categories Uncategorized Post dateNovember 15, 2023Post last updated dateUpdated November 15, 2023 Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by...
Post Categories Uncategorized Post dateNovember 14, 2023Post last updated dateUpdated November 14, 2023 Ase by six hours, which was then maintained for at least 24 hours.Ase by six Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ase by six hours, which was then maintained for at least 24 hours.Ase by...
Post Categories Uncategorized Post dateNovember 14, 2023Post last updated dateUpdated November 14, 2023 Hanism underlying insulin resistance, diabetes, and P2X7 Receptor Antagonist supplier Cardiovascular disease? The prevalent soil Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hanism underlying insulin resistance, diabetes, and P2X7 Receptor Antagonist supplier Cardiovascular disease? The prevalent...
Post Categories Uncategorized Post dateNovember 14, 2023Post last updated dateUpdated November 14, 2023 Nt using the observations in Figure 2 mercury exposure of B10.S mice resulted in important Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nt using the observations in Figure 2 mercury exposure of B10.S mice resulted in...
Post Categories Uncategorized Post dateNovember 14, 2023Post last updated dateUpdated November 14, 2023 Inactive, as analyzed by Northern blot hybridization (Figure 3C). The findingInactive, as analyzed by Northern Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Inactive, as analyzed by Northern blot hybridization (Figure 3C). The findingInactive, as analyzed by...
Post Categories Uncategorized Post dateNovember 14, 2023Post last updated dateUpdated November 14, 2023 In w1118, dcerk1, sirt2, and dcerk1.Caspase 6 medchemexpress dsirt2 fly mitochondria. The amountIn w1118, dcerk1, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In w1118, dcerk1, sirt2, and dcerk1.Caspase 6 medchemexpress dsirt2 fly mitochondria. The amountIn w1118,...
Post Categories Uncategorized Post dateNovember 13, 2023Post last updated dateUpdated November 13, 2023 Ll has sufficient time to sense the gravity vector, as a result, sensing no weight Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ll has sufficient time to sense the gravity vector, as a result, sensing no...
Post Categories Uncategorized Post dateNovember 13, 2023Post last updated dateUpdated November 13, 2023 Dead from EBV may be embalmed (False) Right answers in parenthesis.Pre-workshop (n = 285) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time1 min read Dead from EBV may be embalmed (False) Right answers in parenthesis.Pre-workshop (n = 285)...
Post Categories Uncategorized Post dateNovember 13, 2023Post last updated dateUpdated November 13, 2023 Grams of EPA+DHA every day are suggested below a physician's care. Around 30 million folks Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Grams of EPA+DHA every day are suggested below a physician’s care. Around 30 million...
Post Categories Uncategorized Post dateNovember 13, 2023Post last updated dateUpdated November 13, 2023 Interaction in between host cells and bacteria. Additionally, we demonstrate thatInteraction between host cells and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Interaction in between host cells and bacteria. Additionally, we demonstrate thatInteraction between host cells...
Post Categories Uncategorized Post dateNovember 13, 2023Post last updated dateUpdated November 13, 2023 Sponding band photos from the MEFs. MWAs. The cells were lysedSponding band images from the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sponding band photos from the MEFs. MWAs. The cells were lysedSponding band images from...
Post Categories Uncategorized Post dateNovember 11, 2023Post last updated dateUpdated November 11, 2023 Hances airway fluid absorption. The net result is actually a reduction in airway surface liquid Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hances airway fluid absorption. The net result is actually a reduction in airway surface...
Post Categories Uncategorized Post dateNovember 11, 2023Post last updated dateUpdated November 11, 2023 Ration and clonogenic activity K-RAS mutation outcomes in constitutive K-RAS activity, as demonstrated by a Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ration and clonogenic activity K-RAS mutation outcomes in constitutive K-RAS activity, as demonstrated by...
Post Categories Uncategorized Post dateNovember 10, 2023Post last updated dateUpdated November 10, 2023 N common first-line regimen in PTCL; having said that, for probably the most frequentN standard Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read N common first-line regimen in PTCL; having said that, for probably the most frequentN...
Post Categories Uncategorized Post dateNovember 10, 2023Post last updated dateUpdated November 10, 2023 Wafosis Co., Tokyo, Japan). The Drosophila heads have been examined by scanningWafosis Co., Tokyo, Japan). Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Wafosis Co., Tokyo, Japan). The Drosophila heads have been examined by scanningWafosis Co., Tokyo,...
Post Categories Uncategorized Post dateNovember 9, 2023Post last updated dateUpdated November 9, 2023 Topomer analysis. Right here, we present the initial broad mGluR5 drug analysis of ECM protein Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Topomer analysis. Right here, we present the initial broad mGluR5 drug analysis of ECM...
Post Categories Uncategorized Post dateNovember 9, 2023Post last updated dateUpdated November 9, 2023 Rface with the TT. The nominal CRU model includes a square 7 ?7 array of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rface with the TT. The nominal CRU model includes a square 7 ?7 array...
Post Categories Uncategorized Post dateNovember 9, 2023Post last updated dateUpdated November 9, 2023 T 67 dpi by a recovery phenotype associated having a high quantity of repressed transcripts, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read T 67 dpi by a recovery phenotype associated having a high quantity of repressed...
Post Categories Uncategorized Post dateNovember 9, 2023Post last updated dateUpdated November 9, 2023 And shRNA-expressing (Turbo-GFP ) cells had been sorted by a fluorescence-activated cell sorterAnd shRNA-expressing (Turbo-GFP Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read And shRNA-expressing (Turbo-GFP ) cells had been sorted by a fluorescence-activated cell sorterAnd shRNA-expressing...
Post Categories Uncategorized Post dateNovember 9, 2023Post last updated dateUpdated November 9, 2023 In w1118, dcerk1, sirt2, and dcerk1.dsirt2 fly mitochondria. The amountIn w1118, dcerk1, sirt2, and dcerk1.dsirt2 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In w1118, dcerk1, sirt2, and dcerk1.dsirt2 fly mitochondria. The amountIn w1118, dcerk1, sirt2, and...
Post Categories Uncategorized Post dateNovember 8, 2023Post last updated dateUpdated November 8, 2023 Em for three min, which was proven to be enough for equilibration. The information are Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Em for three min, which was proven to be enough for equilibration. The information...
Post Categories Uncategorized Post dateNovember 8, 2023Post last updated dateUpdated November 8, 2023 Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue fluid, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue...
Post Categories Uncategorized Post dateNovember 8, 2023Post last updated dateUpdated November 8, 2023 D pre-column. The wavelength was set at 230 nm with a flowD pre-column. The wavelength Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D pre-column. The wavelength was set at 230 nm with a flowD pre-column. The...
Post Categories Uncategorized Post dateNovember 8, 2023Post last updated dateUpdated November 8, 2023 With a T-DNA organisational structure conducive to effective integration of clonedHaving a T-DNA organisational structure Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read With a T-DNA organisational structure conducive to effective integration of clonedHaving a T-DNA organisational...
Post Categories Uncategorized Post dateNovember 7, 2023Post last updated dateUpdated November 7, 2023 Tion. The mTOR pathway was over-activated in lal-/- ECs, and inhibition of mTOR in lal-/- Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tion. The mTOR pathway was over-activated in lal-/- ECs, and inhibition of mTOR in...
Post Categories Uncategorized Post dateNovember 7, 2023Post last updated dateUpdated November 7, 2023 Btained with TNP-ATP as an antagonist. A317491 has no structural similarity to any on the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Btained with TNP-ATP as an antagonist. A317491 has no structural similarity to any on...
Post Categories Uncategorized Post dateNovember 7, 2023Post last updated dateUpdated November 7, 2023 U et al.US FDA companion diagnostics co-development requirementan investigator-initiated trial (28) or previously undetected ALK Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read U et al.US FDA companion diagnostics co-development requirementan investigator-initiated trial (28) or previously undetected...
Post Categories Uncategorized Post dateNovember 7, 2023Post last updated dateUpdated November 7, 2023 E and choose cargo. (v) PKCθ manufacturer autophagy receptors including p62 regulateE and select cargo. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E and choose cargo. (v) PKCθ manufacturer autophagy receptors including p62 regulateE and select...
Post Categories Uncategorized Post dateNovember 7, 2023Post last updated dateUpdated November 7, 2023 Rnatant was recentrifuged at 16,000 g for 15 min, along with the pellets wereRnatant was Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rnatant was recentrifuged at 16,000 g for 15 min, along with the pellets wereRnatant...
Post Categories Uncategorized Post dateNovember 6, 2023Post last updated dateUpdated November 6, 2023 Ready from 8:two L:S could remain in dissolution medium but theReady from 8:two L:S could Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ready from 8:two L:S could remain in dissolution medium but theReady from 8:two L:S...
Post Categories Uncategorized Post dateNovember 6, 2023Post last updated dateUpdated November 6, 2023 Ivided into blank control group, model (H. pylori) group in which cells have been treated Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ivided into blank control group, model (H. pylori) group in which cells have been...
Post Categories Uncategorized Post dateNovember 6, 2023Post last updated dateUpdated November 6, 2023 Te-sex pheromonal odors: 6-OHDA lesions of DA terminals in this area abolished the hardwired preference Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Te-sex pheromonal odors: 6-OHDA lesions of DA terminals in this area abolished the hardwired...
Post Categories Uncategorized Post dateNovember 6, 2023Post last updated dateUpdated November 6, 2023 S described over was applied. RNA Interference and Northern Analysis. DeliveryS described above was utilized. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S described over was applied. RNA Interference and Northern Analysis. DeliveryS described above was...
Post Categories Uncategorized Post dateNovember 4, 2023Post last updated dateUpdated November 4, 2023 Al handle in excess of drug release. Photodegradable groups are used in the presence of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Al handle in excess of drug release. Photodegradable groups are used in the presence...
Post Categories Uncategorized Post dateNovember 4, 2023Post last updated dateUpdated November 4, 2023 E to examine substantial parameter spaces to figure out how mGluR7 medchemexpress unique signalingE to Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E to examine substantial parameter spaces to figure out how mGluR7 medchemexpress unique signalingE...
Post Categories Uncategorized Post dateNovember 4, 2023Post last updated dateUpdated November 4, 2023 Mbrane association correlates using the assembly status and subunit composition ofMbrane association correlates with the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Mbrane association correlates using the assembly status and subunit composition ofMbrane association correlates with...
Post Categories Uncategorized Post dateNovember 3, 2023Post last updated dateUpdated November 3, 2023 Ells/well) cultured for 24 h have been co-cultured with B16-F10 or iB16-shGCR cells (5.06105cells/well; pre-cultured Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ells/well) cultured for 24 h have been co-cultured with B16-F10 or iB16-shGCR cells (5.06105cells/well;...
Post Categories Uncategorized Post dateNovember 3, 2023Post last updated dateUpdated November 3, 2023 Isms are required to define potential treatments (e.g. by means of diet programIsms are essential Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Isms are required to define potential treatments (e.g. by means of diet programIsms are...
Post Categories Uncategorized Post dateNovember 3, 2023Post last updated dateUpdated November 3, 2023 Decline is accounted for Caspase medchemexpress largely by a rise in state 4 respirationDecline is Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Decline is accounted for Caspase medchemexpress largely by a rise in state 4 respirationDecline...
Post Categories Uncategorized Post dateNovember 2, 2023Post last updated dateUpdated November 2, 2023 Identified as pan-cancer mechanisms of response (PI Score .1.0; Step five). A subset in the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Identified as pan-cancer mechanisms of response (PI Score .1.0; Step five). A subset in...
Post Categories Uncategorized Post dateNovember 1, 2023Post last updated dateUpdated November 1, 2023 Erent concentrations (four, eight, 16 and 20 mg/ml). Following the emulsion was added into every Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Erent concentrations (four, eight, 16 and 20 mg/ml). Following the emulsion was added into...
Post Categories Uncategorized Post dateOctober 31, 2023Post last updated dateUpdated October 31, 2023 Detected a great deal larger amounts of Pb (two,20014,200 ng/g DW) in red and brown Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Detected a great deal larger amounts of Pb (two,20014,200 ng/g DW) in red and...
Post Categories Uncategorized Post dateOctober 30, 2023Post last updated dateUpdated October 30, 2023 Ced having a new media without GNODE, and cells had been returnedCed having a new Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ced having a new media without GNODE, and cells had been returnedCed having a...
Post Categories Uncategorized Post dateOctober 29, 2023Post last updated dateUpdated October 29, 2023 Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) 10:58-The Assessment of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) 10:58-The Assessment of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud...
Post Categories Uncategorized Post dateOctober 26, 2023Post last updated dateUpdated October 26, 2023 Amino acid deletion related with CdLS [1]. The level of rRNA inAmino acid deletion related Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Amino acid deletion related with CdLS . The level of rRNA inAmino acid deletion...
Post Categories Uncategorized Post dateOctober 26, 2023Post last updated dateUpdated October 26, 2023 Inactive, as analyzed by Northern blot hybridization (Figure 3C). The gettingInactive, as analyzed by Northern Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Inactive, as analyzed by Northern blot hybridization (Figure 3C). The gettingInactive, as analyzed by...
Post Categories Uncategorized Post dateOctober 24, 2023Post last updated dateUpdated October 24, 2023 Or comparison, the levels of PEA measured two h immediately after single administration of URB597 Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Or comparison, the levels of PEA measured two h immediately after single administration of...
Post Categories Uncategorized Post dateOctober 24, 2023Post last updated dateUpdated October 24, 2023 Insulin lispro and insulin aspart.23 Other in vitro studies have also shown that insulin aspart Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Insulin lispro and insulin aspart.23 Other in vitro studies have also shown that insulin...
Post Categories Uncategorized Post dateOctober 24, 2023Post last updated dateUpdated October 24, 2023 Tracer by injection or gavage is much more complicated than simple incubation with ROS probes. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tracer by injection or gavage is much more complicated than simple incubation with ROS...
Post Categories Uncategorized Post dateOctober 24, 2023Post last updated dateUpdated October 24, 2023 Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter treatment of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter treatment...
Post Categories Uncategorized Post dateOctober 24, 2023Post last updated dateUpdated October 24, 2023 Thanol. For Western blotting, mouse anti-DDK antibody (OriGene) was made use of atThanol. For Western Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Thanol. For Western blotting, mouse anti-DDK antibody (OriGene) was made use of atThanol. For...
Post Categories Uncategorized Post dateOctober 23, 2023Post last updated dateUpdated October 23, 2023 Fore, the probability that the NPY Y5 receptor Formulation nasopharyngeal carcinoma within this patient was Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Fore, the probability that the NPY Y5 receptor Formulation nasopharyngeal carcinoma within this patient...
Post Categories Uncategorized Post dateOctober 23, 2023Post last updated dateUpdated October 23, 2023 Rome, this will incredibly probably influence clinical practice and inform investigators concerning the pathogenesis of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Rome, this will incredibly probably influence clinical practice and inform investigators concerning the pathogenesis...
Post Categories Uncategorized Post dateOctober 23, 2023Post last updated dateUpdated October 23, 2023 He manufacturer's directions (R D Systems, Minneapolis, Minnesota). Therapy with cathepsin-B inhibitor CA-074. CA-074 (L-3-trans(Propylcarbamoyl)oxirane-2-carbonyl)-L-isoleucyl-L-proline) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read He manufacturer’s directions (R D Systems, Minneapolis, Minnesota). Therapy with cathepsin-B inhibitor CA-074. CA-074...
Post Categories Uncategorized Post dateOctober 23, 2023Post last updated dateUpdated October 23, 2023 Chemotherapy at an earlier time point. Future prospective research are warrantedChemotherapy at an earlier time Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Chemotherapy at an earlier time point. Future prospective research are warrantedChemotherapy at an earlier...
Post Categories Uncategorized Post dateOctober 23, 2023Post last updated dateUpdated October 23, 2023 Ncorporation, normalized to empty vector or nontargeted shRNA management lines. PNcorporation, normalized to empty vector Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ncorporation, normalized to empty vector or nontargeted shRNA management lines. PNcorporation, normalized to empty...
Post Categories Uncategorized Post dateOctober 22, 2023Post last updated dateUpdated October 22, 2023 Ion of aggrecan and collagen II, though increasing production of collagen I [Mayne et al., Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ion of aggrecan and collagen II, though increasing production of collagen I [Mayne et...
Post Categories Uncategorized Post dateOctober 22, 2023Post last updated dateUpdated October 22, 2023 Mg/ml) for 3 h at 37 1C. After derivation, iPSCs had been initially grown on Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Mg/ml) for 3 h at 37 1C. After derivation, iPSCs had been initially grown...
Post Categories Uncategorized Post dateOctober 22, 2023Post last updated dateUpdated October 22, 2023 Ividual shown in Fig. 3).British Journal of NutritionDiscussionOur interest in dietary lactose as an immunomodulatory Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ividual shown in Fig. 3).British Journal of NutritionDiscussionOur interest in dietary lactose as an...
Post Categories Uncategorized Post dateOctober 22, 2023Post last updated dateUpdated October 22, 2023 E basic amino acid permease Gap1, on which TORC1-dependent, RspE general amino acid permease Gap1, Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E basic amino acid permease Gap1, on which TORC1-dependent, RspE general amino acid permease...
Post Categories Uncategorized Post dateOctober 22, 2023Post last updated dateUpdated October 22, 2023 Sis.Evidence-Based Complementary and Option Medicine utilised as inhibitors. The finalSis.Evidence-Based Complementary and Alternative Medicine utilised Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Sis.Evidence-Based Complementary and Option Medicine utilised as inhibitors. The finalSis.Evidence-Based Complementary and Alternative Medicine...
Post Categories Uncategorized Post dateOctober 18, 2023Post last updated dateUpdated October 18, 2023 Nd: C, 70.89; H, 5.26; N, five.57.NoteASSOCIATED CONTENTS Supporting InformationNMR spectra and crystallographic information. Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nd: C, 70.89; H, 5.26; N, five.57.NoteASSOCIATED CONTENTS Supporting InformationNMR spectra and crystallographic information....
Post Categories Uncategorized Post dateOctober 18, 2023Post last updated dateUpdated October 18, 2023 Creased age [20-22]. Similarly, within the present study, the youngest age groups had the highest Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Creased age . Similarly, within the present study, the youngest age groups had the...
Post Categories Uncategorized Post dateOctober 18, 2023Post last updated dateUpdated October 18, 2023 S having Langerhans cell histiocytosis and acquired chemotherapy [138]. Salmonella infection wasS acquiring Langerhans cell Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read S having Langerhans cell histiocytosis and acquired chemotherapy . Salmonella infection wasS acquiring Langerhans...
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 Operties of this molecule, brief half-life, and poor MEK1 site bioavailability make itOperties of this Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Operties of this molecule, brief half-life, and poor MEK1 site bioavailability make itOperties of...
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 Centration-response curves for ET-1 showed enhanced strain generation in the course of isometric vascular smooth Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Centration-response curves for ET-1 showed enhanced strain generation in the course of isometric vascular...
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 Er (Fig. 9A). IK-1 also failed in reporter assays to inhibit R-mediated activation of the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Er (Fig. 9A). IK-1 also failed in reporter assays to inhibit R-mediated activation of...
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 E created for each and every gene for amplification of promoter and IP Antagonist list Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E created for each and every gene for amplification of promoter and IP Antagonist...
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 He second generation. Conclusions: Thinking of the direct and maternal effects ofHe second generation. Conclusions: Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read He second generation. Conclusions: Thinking of the direct and maternal effects ofHe second generation....
Post Categories Uncategorized Post dateOctober 17, 2023Post last updated dateUpdated October 17, 2023 H di-tert-butyldiaziridinone (1) and Pd(PPh3)4 led to a novel ErbB2/HER2 Formulation sequential allylicH di-tert-butyldiaziridinone (1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read H di-tert-butyldiaziridinone (1) and Pd(PPh3)4 led to a novel ErbB2/HER2 Formulation sequential allylicH di-tert-butyldiaziridinone...
Post Categories Uncategorized Post dateOctober 16, 2023Post last updated dateUpdated October 16, 2023 Amide in ameliorating attacks of weakness in HypoPP and hyperkalaemic periodic paralysis will not be Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Amide in ameliorating attacks of weakness in HypoPP and hyperkalaemic periodic paralysis will not...
Post Categories Uncategorized Post dateOctober 16, 2023Post last updated dateUpdated October 16, 2023 Depth analyses of sulfatases of unknown function that had been identified in a genome-wide look Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Depth analyses of sulfatases of unknown function that had been identified in a genome-wide...
Post Categories Uncategorized Post dateOctober 16, 2023Post last updated dateUpdated October 16, 2023 And these proteins synergistically amplified LPS-inducible Edn1 CD40 Inhibitor custom synthesis promoter activity (Fig. 8A). Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read And these proteins synergistically amplified LPS-inducible Edn1 CD40 Inhibitor custom synthesis promoter activity (Fig....
Post Categories Uncategorized Post dateOctober 16, 2023Post last updated dateUpdated October 16, 2023 Systemic LPS-induced inflammation, JQ1 increases the susceptibility to DSS-induced colitis.DISCUSSIONTheSystemic LPS-induced inflammation, JQ1 increases the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Systemic LPS-induced inflammation, JQ1 increases the susceptibility to DSS-induced colitis.DISCUSSIONTheSystemic LPS-induced inflammation, JQ1 increases...
Post Categories Uncategorized Post dateOctober 16, 2023Post last updated dateUpdated October 16, 2023 In relation to NST complexes have been obtained based on the MDIn relation to NST Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read In relation to NST complexes have been obtained based on the MDIn relation to...
Post Categories Uncategorized Post dateOctober 13, 2023Post last updated dateUpdated October 13, 2023 Ar profile. However, broad adoption of this method has been hindered by an incomplete understanding Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ar profile. However, broad adoption of this method has been hindered by an incomplete...
Post Categories Uncategorized Post dateOctober 13, 2023Post last updated dateUpdated October 13, 2023 E patterns were supported by image analyses applying GIS [44] and Daime [32,45] programs and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E patterns were supported by image analyses applying GIS and Daime programs...
Post Categories Uncategorized Post dateOctober 13, 2023Post last updated dateUpdated October 13, 2023 Ranial hypertension. Outcomes are provided as medians (IQR).Abbreviations CT: computedRanial hypertension. Results are given as Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ranial hypertension. Outcomes are provided as medians (IQR).Abbreviations CT: computedRanial hypertension. Results are given...
Post Categories Uncategorized Post dateOctober 13, 2023Post last updated dateUpdated October 13, 2023 Ordingly, fiber bridges have been explicitly placed on this plane using aOrdingly, fiber bridges have Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ordingly, fiber bridges have been explicitly placed on this plane using aOrdingly, fiber bridges...
Post Categories Uncategorized Post dateOctober 12, 2023Post last updated dateUpdated October 12, 2023 O respond to TAM. Chrisholm et al. also showed cytotoxic effects of EGCG alone in Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read O respond to TAM. Chrisholm et al. also showed cytotoxic effects of EGCG alone...
Post Categories Uncategorized Post dateOctober 12, 2023Post last updated dateUpdated October 12, 2023 By contaminated mice was examined employing an experimental strategy described byBy contaminated mice was tested Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read By contaminated mice was examined employing an experimental strategy described byBy contaminated mice was...
Post Categories Uncategorized Post dateOctober 12, 2023Post last updated dateUpdated October 12, 2023 Salvage pathway and hydroxykynurenine inside the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Salvage pathway and hydroxykynurenine inside the de novo pathway, of NADSalvage pathway and hydroxykynurenine...
Post Categories Uncategorized Post dateOctober 11, 2023Post last updated dateUpdated October 11, 2023 D the consequence of preincubation together with the fibril modulators, fluorescence anisotropy of PC/PG (1:1) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read D the consequence of preincubation together with the fibril modulators, fluorescence anisotropy of PC/PG...
Post Categories Uncategorized Post dateOctober 11, 2023Post last updated dateUpdated October 11, 2023 Nsgene expression, the severity from the condition in PD-1 Tg miceNsgene expression, the severity of Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nsgene expression, the severity from the condition in PD-1 Tg miceNsgene expression, the severity...
Post Categories Uncategorized Post dateOctober 11, 2023Post last updated dateUpdated October 11, 2023 Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) ten:58-The Review of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013) Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) ten:58-The Review of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud...
Post Categories Uncategorized Post dateOctober 10, 2023Post last updated dateUpdated October 10, 2023 Ocols. Proteins have been separated on 4-15 gradient sodium dodecyl sulfate (SDS)-polyacrylamide gels and Post author Ubiquitin Ligase- ubiquitin-ligasePost read time38 sec read Ocols. Proteins have been separated on 4-15 gradient sodium dodecyl sulfate (SDS)-polyacrylamide gels and...
Post Categories Uncategorized Post dateOctober 10, 2023Post last updated dateUpdated October 10, 2023 Entation points towards the importance of sustaining the health with the axonal compartment. Whilst it Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Entation points towards the importance of sustaining the health with the axonal compartment. Whilst...
Post Categories Uncategorized Post dateOctober 10, 2023Post last updated dateUpdated October 10, 2023 By the strategy of Bradford,40 Estrogen receptor drug utilizing bovine serum albumin (BSA) asBy the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read By the strategy of Bradford,40 Estrogen receptor drug utilizing bovine serum albumin (BSA) asBy...
Post Categories Uncategorized Post dateOctober 9, 2023Post last updated dateUpdated October 9, 2023 Nduces AMPK activation in pancreatic -cells, which results in an increase in KATP channel trafficking Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Nduces AMPK activation in pancreatic -cells, which results in an increase in KATP channel...
Post Categories Uncategorized Post dateOctober 9, 2023Post last updated dateUpdated October 9, 2023 Tility [57]. They cause membrane rupture by stimulatingPLOS A single | plosone.orgthe ECM remodelling PPARβ/δ Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Tility . They cause membrane rupture by stimulatingPLOS A single | plosone.orgthe ECM remodelling...
Post Categories Uncategorized Post dateOctober 9, 2023Post last updated dateUpdated October 9, 2023 Dothelial cell monolayer integrity and barrier properties by means of paracrine signaling mechanismsDothelial cell monolayer Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Dothelial cell monolayer integrity and barrier properties by means of paracrine signaling mechanismsDothelial cell...
Post Categories Uncategorized Post dateOctober 9, 2023Post last updated dateUpdated October 9, 2023 On might be an essential aspect within this metabolic reprogramming (KimOn may very well be Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read On might be an essential aspect within this metabolic reprogramming (KimOn may very well...
Post Categories Uncategorized Post dateOctober 8, 2023Post last updated dateUpdated October 8, 2023 Hat these effects happen as a consequence of various, metformin-induced adjustments in signaling each upstream Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Hat these effects happen as a consequence of various, metformin-induced adjustments in signaling each...
Post Categories Uncategorized Post dateOctober 8, 2023Post last updated dateUpdated October 8, 2023 Erefore, mixture therapy with milrinone and low-dose landiolol may possibly be aErefore, combination therapy with Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Erefore, mixture therapy with milrinone and low-dose landiolol may possibly be aErefore, combination therapy...
Post Categories Uncategorized Post dateOctober 8, 2023Post last updated dateUpdated October 8, 2023 Pure water at reflux for 24 h effected clean hydrolysis of yourPure water at reflux Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Pure water at reflux for 24 h effected clean hydrolysis of yourPure water at...
Post Categories Uncategorized Post dateOctober 7, 2023Post last updated dateUpdated October 7, 2023 E experiments is located in Supporting Data. In experiments on NO/nitrite release from BChE manufacturer Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read E experiments is located in Supporting Data. In experiments on NO/nitrite release from BChE...
Post Categories Uncategorized Post dateOctober 7, 2023Post last updated dateUpdated October 7, 2023 Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction within the Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction within...
Post Categories Uncategorized Post dateOctober 7, 2023Post last updated dateUpdated October 7, 2023 Ssion construct we observed that PTEN is often a direct target ofSsion construct we observed Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Ssion construct we observed that PTEN is often a direct target ofSsion construct we...
Post Categories Uncategorized Post dateOctober 7, 2023Post last updated dateUpdated October 7, 2023 Pure water at reflux for 24 h effected clean hydrolysis in thePure water at reflux Post author Ubiquitin Ligase- ubiquitin-ligasePost read time2 min read Pure water at reflux for 24 h effected clean hydrolysis in thePure water at...