Ginkgolides

This product contains a mixture of Ginkgolides A, B and C found in Ginkgo.

References PubMed ID：:http://www.ncbi.nlm.nih.gov/pubmed/18927109

Purity	≥98%
Solubility	Insoluble in water. Soluble in DMSO.
Appearance	White Powder

RVX 208

Share this post on:

Author: Ubiquitin Ligase- ubiquitin-ligase

Posts navigation

< ICAM-1 and E-selectin mRNA were not affected by HFD. No gross morphological changes as assessed by hematoxylin staining were observed in retinal sections of dyslipidemic mice when compared to normolipidemic mice

Espir Crit Care Med 161: 646664. 2. Bitterman PB, Rennard SI, Keogh BA, Wewers >

IL10RB (Human) Recombinant Protein

JAM-B Protein

HSD11B2 (Human) Recombinant Protein (Q01)

Influenza A H3N2 (A/Victoria/361/2011) Hemagglutinin Protein (His)

HOXB1 (Human) Recombinant Protein (P01)

Influenza A H1N1 (A/swine/Denmark/12813-1/2004) Hemagglutinin/HA Protein (His)

HK1 (Human) Recombinant Protein (Q01)

Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Hemagglutinin/HA Protein (His)

IL-3R alpha/CD123 Protein

GPER (Human) Recombinant Protein

IL-18BP Protein

GABRE (Human) Recombinant Protein (P01)

IGFBP-2 Protein

CD7 (Human) Recombinant Protein

IL-11 Protein

CD276 (Human) Recombinant Protein

Cxcl12 (Mouse) Recombinant Protein

DHH (Human) Recombinant Protein

FXN (Human) Recombinant Protein (P01)

CD40 (Human) Recombinant Protein

IFNA1 (Human) Recombinant Protein

IFI30 (Human) Recombinant Protein

FOXI1 (Human) Recombinant Protein (P01)

Il4 (Mouse) Recombinant Protein

IL7 (Human) Recombinant Protein

CD47 (Human) Recombinant Protein

AKR1B1 (Human) Recombinant Protein (P01)

CD40LG (Human) Recombinant Protein

SNAPC1 (Human) Recombinant Protein

FASN (Human) Recombinant Protein (Q01)

Cynomolgus IL-4 R alpha/CD124 Protein 3107

Neutrophil Elastase (Human) Native Protein

Cynomolgus BAFFR/TNFRSF13C Protein 4400

Ifng (Mouse) Recombinant Protein

Biotinylated Human Syndecan-1 Protein 3678

S1 (SARS-CoV) Recombinant Protein

Biotinylated Human LILRB2/CD85d/ILT4 Protein 4781

PDGFRB (Human) Recombinant Protein

Mouse PD-1/PDCD1 Protein 4249

ACTN4 (Human) Recombinant Protein (Q02)

ESRRA (Human) Recombinant Protein (P01)

Mouse IL-31 RA Protein 3955

ACRV1 (Human) Recombinant Protein (P01)

EGFR (Human) Recombinant Protein

Mouse CD200/OX-2 Protein 3839

Human Siglec-3 / CD33 Protein, His Tag (MALS verified)

Ovalbumin (Egg White)

gp120 (HIV-1/Clade B) Recombinant Protein

Human Her2 / ErbB2 (S310Y) Protein, His Tag (MALS verified)

HA1 (H9N2) (A/Guinea fowl/Hong Kong/WF10/99) Recombinant Protein

Human MOG/Myelin Oligodendrocyte Glycoprotein Protein 3463

Human BTN1A1 / Butyrophilin Protein, Fc Tag

Human IL-31 RA Protein 4008

Human BTLA (31-150) Protein, Mouse IgG2a Fc Tag (MALS verified)

CXCL12 (Beta) (Human) Recombinant Protein

Human IL-1 R9 Protein 2311

Canine TIGIT Protein, His Tag (MALS verified)

Il2 (Mouse) Recombinant Protein

Rhesus macaque PCSK9 Protein, His Tag

VAMP5 (Human) Recombinant Protein

PPIF (Human) Recombinant Protein

DDI1 (Human) Recombinant Protein (P01)

OR56B1 (Human) Recombinant Protein

THEMIS (Human) Recombinant Protein (P01)

ECGF1 (Human) Recombinant Protein (P01)

RASGEF1C (Human) Recombinant Protein (P01)

GPR97 (Human) Recombinant Protein

TIGD1 (Human) Recombinant Protein (P01)

MGC42105 (Human) Recombinant Protein (Q01)

C22orf15 (Human) Recombinant Protein (P01)

ERICH1 (Human) Recombinant Protein (P01)

OR6B3 (Human) Recombinant Protein

RNF36 (Human) Recombinant Protein (Q01)

RAET1E (Human) Recombinant Protein (P01)

ACVR1C (Human) Recombinant Protein (P01)

C18orf37 (Human) Recombinant Protein (P01)

Anti-Human ALK1/ACVRL1 Antibody Biosimilar

AKR1C1 (Human) Recombinant Protein (P01)

Recombinant Human DKK2 Protein

Anti-Human CD123/IL3RA Antibody Biosimilar

CCDC5 (Human) Recombinant Protein (Q01)

Recombinant Human EGF Like Domain Protein, Multiple 6 (EGFL6)

TMEM200A (Human) Recombinant Protein (P01)

Recombinant Human Collagen Type III Alpha 1 (COL3a1)

VWF Monoclonal Antibody (OTI1D3), TrueMAB™

Recombinant Interleukin 18 Receptor 1 (IL18R1)

VSNL1 Monoclonal Antibody (OTI3G6), TrueMAB™

CG018 (Human) Recombinant Protein (P01)

Recombinant Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc tag)

VISTA Monoclonal Antibody (B7H5DS8), PE-Cyanine7, eBioscience™

VKORC1L1 Polyclonal Antibody

KRTAP4-4 (Human) Recombinant Protein (P01)

Recombinant Human EphB2 Protein (aa 570-987, His &GST Tag)

VIM Polyclonal Antibody, MaxPab™

PCGF5 (Human) Recombinant Protein (P01)

PCBD2 (Human) Recombinant Protein (P01)

VASP Monoclonal Antibody (OTI1F3), TrueMAB™

TAS1R1 (Human) Recombinant Protein (Q01)

Recombinant Rat CD55 / DAF Protein (Fc tag)

rabbit anti-beta actin monoclonal antibody 9038

REC14 (Human) Recombinant Protein (P01)

Recombinant Human MSR1 / SCARA1 / CD204 Protein (His tag)

Urelumab Recombinant Human Monoclonal Antibody

Recombinant Mouse CD19 / Leu-12 Protein (His tag)

USP53 Polyclonal Antibody, MaxPab™

Recombinant Human CD97 Protein (Fc tag)

USP13 Monoclonal Antibody (OTI4G1), TrueMAB™

Recombinant Human Mesothelin/MSLN/CAK1/MPF Protein(C-Fc)

UNG Monoclonal Antibody (OTI1G2)

Recombinant Human CD47 Protein

UCHL3 Recombinant Rabbit Monoclonal Antibody (ARC1874)

Eukaryotic Calreticulin (CALR)

UCHL5IP Polyclonal Antibody

UBE2N Monoclonal Antibody (4C11-G11)

Recombinant Human NRAS Protein (His tag)

U2AF1L4 Polyclonal Antibody

Recombinant Human S100A2 Protein (Fc tag)

Recombinant Mouse NEGR1 Protein (His tag)

Recombinant Mouse Pleiotrophin / PTN / HB-GAM Protein

Thymidine Phosphorylase Monoclonal Antibody (P-GF.44C)

Recombinant Mouse Legumain/Asparaginyl Endopeptidase Protein

Recombinant Human Kallikrein 11 Protein

Recombinant Human Activator of Hsp90 ATPase-1 /AHA1 Protein

TTC21B Polyclonal Antibody

Recombinant Mouse TSLP Protein (His tag)

Recombinant Human GABA Protein

ORAI2 (Human) Recombinant Protein (P01)

TRK fused gene Polyclonal Antibody

ALS2CR8 (Human) Recombinant Protein (P01)

TRIM5 gamma Polyclonal Antibody

LRRC2 (Human) Recombinant Protein (P01)

TRF2 Monoclonal Antibody (3H6B4)

ZNF343 (Human) Recombinant Protein (P02)

C20orf81 (Human) Recombinant Protein (P01)

TRAF1 (TNFR-Associated Factor 1) (Lymphomatoid Papulosis Marker) Monoclonal Antibody (TRAF1/3299)

SIL1 (Human) Recombinant Protein (P01)

TOP2A Monoclonal Antibody (OTI1E11), TrueMAB™

CHP2 (Human) Recombinant Protein (P01)

ANKRA2 (Human) Recombinant Protein (P01)

Ifficult to prepare and we currently only offer ddC. An alternative

TNFS15/VEGI (Vascular Endothelial Growth Inhibitor) Recombinant Rabbit Monoclonal Antibody (VEGI/7799R)

VPS18 (Human) Recombinant Protein (Q01)

482nm is 78,300 L/mol.cm. Our experimental work has shown that

TNFR1 Monoclonal Antibody (47803)

TWSG1 (Human) Recombinant Protein (Q01)

Inc. to recommence the supply of these two valuable products. We

TMEM163 Polyclonal Antibody

TMEM68 Polyclonal Antibody

TMEM232 Polyclonal Antibody

TLE1 Monoclonal Antibody (OTI1D6), TrueMAB™

TIPARP Polyclonal Antibody

TIGIT Monoclonal Antibody (MBSA43), Alexa Fluor™ 647, eBioscience™

TIA1 Polyclonal Antibody, Biotin

integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)

TGM2 Monoclonal Antibody (1A6)

TFF3 Monoclonal Antibody (OTI4D10), TrueMAB™

TER-119 Monoclonal Antibody (TER-119), PE

TRERF1 (Human) Recombinant Protein (Q01)

INO80 complex subunit B

Ibentatug Biosimilar

interleukin 20 receptor, alpha

TCR V beta 8a Monoclonal Antibody (16G8), FITC

COL19A1 (Human) Recombinant Protein (Q01)

acyl-CoA synthetase medium-chain family member 5

TCF7 Monoclonal Antibody (1B3)

CCDC40 (Human) Recombinant Protein (P01)

heat shock 70kDa protein 12A

TACC3 Monoclonal Antibody (OTI8B7), TrueMAB™

ARL15 (Human) Recombinant Protein (P01)

5-hydroxymethylcytosine (hmC) binding, ES cell-specific

Synaptotagmin-11 Polyclonal Antibody

CPVL (Human) Recombinant Protein (P01)

HECT domain containing E3 ubiquitin protein ligase 1

Streptococcus Group A Monoclonal Antibody (HSA12-340.5)

gasdermin C

Stathmin Polyclonal Antibody

G protein-coupled receptor 26

Sigma-1 Receptor Polyclonal Antibody

golgin B1

Sam50 Monoclonal Antibody (2H6H9)

gastric inhibitory polypeptide

SYCP3 Monoclonal Antibody (OTI1B11), TrueMAB™

gem (nuclear organelle) associated protein 4

SUMO1 Polyclonal Antibody, MaxPab™

GTPase activating protein (SH3 domain) binding protein 2

SULT1A1 Monoclonal Antibody (OTI5F1), TrueMAB™

forkhead box P3

STK11IP Polyclonal Antibody, MaxPab™

fibroblast growth factor 9

STAT5A Monoclonal Antibody (OTI3F9), TrueMAB™

F-box protein 8

ST2 (IL1RL1) Monoclonal Antibody (OTI1H1), TrueMAB™

family with sequence similarity 227, member B

SSH3 Polyclonal Antibody

family with sequence similarity 117, member B

F2R like thrombin or trypsin receptor 3

SPOCK3 Polyclonal Antibody, MaxPab™

adipogenesis associated, Mth938 domain containing

SPG7 Polyclonal Antibody, MaxPab™

eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa

SP140L Polyclonal Antibody

SOX17 Monoclonal Antibody (OTI3H5)

estrogen receptor binding site associated, antigen, 9

SOAT2 Polyclonal Antibody

double C2-like domains, alpha

SNAP23 Recombinant Rabbit Monoclonal Antibody (JA73-15)

SMPD2 Polyclonal Antibody

HSPC121 (Human) Recombinant Protein (Q01)

Sry-box 21

SMAD3 Monoclonal Antibody (4G12)

dermcidin

SLIRP/C14orf156 Polyclonal Antibody, Cyanine3

SLC46A1 Polyclonal Antibody

CWF19-like 1, cell cycle control (S. pombe)

SIN3A Recombinant Rabbit Monoclonal Antibody (3W9A10)

crystallin, gamma N

SHMT2 Monoclonal Antibody (5E7)

carboxypeptidase A2 (pancreatic)

SHARPIN Monoclonal Antibody (3A9E2)

clusterin associated protein 1

SFTPA1 Monoclonal Antibody (C5)

cell death-inducing DFFA-like effector c

SF3B2 Monoclonal Antibody (2A2)

coiled-coil-helix-coiled-coil-helix domain containing 2

SERPINB6 Polyclonal Antibody

cilia and flagella associated protein 57

SEC22L2 Polyclonal Antibody, MaxPab™

cadherin 26

SDS Monoclonal Antibody (OTI1H5), TrueMAB™

chemokine (C-C motif) receptor 6

SCRG1 Polyclonal Antibody

coiled-coil domain containing 173

SCEL Monoclonal Antibody (4B12)

Leucine rich repeat containing g protein-coupled receptor 5

SARS/SARS-CoV-2 Nucleocapsid Polyclonal Antibody

cullin-associated and neddylation-dissociated 1

SARS-CoV-2 Spike Protein S2 Polyclonal Antibody

chromosome 4 open reading frame 3

SARS-CoV-2 N Protein Monoclonal Antibody (OTI9F7), TrueMAB™

chromosome 21 open reading frame 59

SAE1 Monoclonal Antibody (1G4-1G5)

S100B Monoclonal Antibody (OTI2H10), TrueMAB™

BTG family, member 3

S100A11 Recombinant Rabbit Monoclonal Antibody (118)

bone morphogenetic protein 8b

Ring1B Monoclonal Antibody (3-3)

B9 protein domain 2

Rb Recombinant Rabbit Monoclonal Antibody (2R4M3)

zinc finger and SCAN domain containing 5A

RUNX3 Monoclonal Antibody (A7B7)

zinc finger protein 622

RS1 Polyclonal Antibody

zinc finger protein 48

RPS6KB1 Polyclonal Antibody

zinc finger protein 319

RPL13 Recombinant Rabbit Monoclonal Antibody (JE62-34)

zinc finger, CCHC domain containing 7

zinc finger and BTB domain containing 41

RNF36 Polyclonal Antibody

YY1 associated factor 2

RNF146 Polyclonal Antibody

WD repeat domain 77

VGF nerve growth factor inducible

Efzimfotase Alfa Biosimilar

uridine phosphorylase 2

Anti-Human MAPT/Tau/PHF-tau Biosimilar

uridine-cytidine kinase 1-like 1

thioredoxin domain containing 17

tuberous sclerosis 2

tripartite motif containing 29

Golgi protein 58k Polyclonal Antibody

tumor necrosis factor receptor superfamily, member 8

GluR3 Monoclonal Antibody (3B3)

acetyl-CoA acyltransferase 1

Gata-3 Monoclonal Antibody (TWAJ), Alexa Fluor™ 700, eBioscience™

transmembrane protein 102

GUCY1A1 Polyclonal Antibody

translocase of inner mitochondrial membrane domain containing 1

GSTT1 Monoclonal Antibody (1A4C11), CoraLite® Plus 488

testis expressed 15

GSK3 alpha/beta Polyclonal Antibody

transducin beta like 1 Y-linked

GPT2 Polyclonal Antibody, MaxPab™

Rho guanine nucleotide exchange factor (GEF) 35

GPR91 (SUCNR1) (extracellular) Polyclonal Antibody, FITC

striatin interacting protein 1

GPR137B Polyclonal Antibody

SRR1 domain containing

GORAB Monoclonal Antibody (OTI4F11)

spermatogenesis and centriole associated 1-like

GNMT Monoclonal Antibody (1B5E3)

sorting nexin 16

Anti-Human CD223/LAG3 Biosimilar

snail family transcriptional repressor 1

Anti-Human F11 Biosimilar

solute carrier family 38, member 6

Eflimrufusp Alfa Biosimilar

solute carrier family 34 (type II sodium/phosphate contransporter), member 2

Anti-Human VSIR/VISTA Antibody Biosimilar

apolipoprotein M

serine hydroxymethyltransferase 1

apolipoprotein B

PF-5190457

SDA1 domain containing 1

Ro-51

SET binding factor 1

LQ059

ribosome binding protein 1

anti-PD-L1 / X antibody, Betta Pharma

ring finger protein 32

anti-CD98 antibody, Huahui Health

RIO kinase 3

JMB2003

raftlin, lipid raft linker 1

HK010

RNA binding motif protein 44

ACEI Polyclonal Antibody

Rap guanine nucleotide exchange factor 2

dafsolimab setaritox

protein tyrosine phosphatase, receptor type, F

FYB201

proteasome (prosome, macropain) subunit, beta type, 4

KN053

phosphoribosyl pyrophosphate synthetase 1

anti-PD-1 antibody, NIH

protein phosphatase 1, regulatory subunit 15A

anti-NGF antibody, Sichuan University

phosphoribosyl pyrophosphate amidotransferase

anti-IL-23 antibody, VHsquared

proline-rich nuclear receptor coactivator 1

anti-Progranulin antibody, Lundbeck

plakophilin 2

APC membrane recruitment protein 1

anti-CD40/X antibody, Quine Medical AB

pyridoxal (pyridoxine, vitamin B6) phosphatase

anti-CD19 antibody, Sloan-Kettering

alpha-kinase 2

poly (ADP-ribose) glycohydrolase

IBI327

peptidyl arginine deiminase, type I

anti-TNFα antibody, Zhejiang University

OCIA domain containing 2

anti-Her3 antibody, University of Texas at Austin

negative regulator of ubiquitin-like proteins 1

anti-Lactadherin antibody, Thrombogenics

nuclear receptor subfamily 0 group B member 1

anti-TSPAN33 antibody, Eli lily

N-myristoyltransferase 1

anti-IL-1RAP antibody, Bluefin Biomedicine

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa

anti-Her2 antibody, Redwood

N-acetylneuraminic acid synthase

anti-Claudin 1 antibody, Osaka University

myosin light chain kinase

anti-Her1/Her2 antibody, Novartis

anti-PD-1 antibody, Georgiamune

ARS-1620, a G12C-Specific Inhibitor, is a Promising Candidate for KRAS-mutant Cancer

DXC009

USL311 is a Selective CXCR4 Antagonist, with Anti-Tumor Activity

mPEG23-OCH2CH2COONHS Ester

anti-CKAP2 antibody, Sungkyunkwan University

Maleimide-(CH2)5-COOH

rocatinlimab

ABCC5 Monoclonal Antibody (2H10F11), CoraLite® Plus 488

anti-OX40 antibody, IGM Bio

Rabbit anti-HDAC6 Polyclonal Antibody

anti-TMPRSS11E antibody, Forerunner

Rabbit anti-WNT2 Polyclonal Antibody

anti-GPRC5D antibody, Memorial Sloan Kettering Cancer Center

Rabbit anti-RBCK1 Polyclonal Antibody(N-term)

anti-HLA-I antibody, Chugai

ACSL4 Recombinant Rabbit Monoclonal Antibody (JE56-33)

BTI-322

Rabbit anti-Integrin β3 Polyclonal Antibody

anti-CD3 / fusion antibody, Arizona State University

Rabbit anti-HMOX1 Polyclonal Antibody

anti-5T4/CD3 antibody, Amgen

Rabbit anti-CLIC3 Polyclonal Antibody

omalizumab biosimilar, BioXpress Therapeutics

Rabbit anti-CHSY1 Polyclonal Antibody

AFM 28

Rabbit anti-SASH1 Polyclonal Antibody

CS1-BCMA CAR-T

Annexin V Polyclonal Antibody, CoraLite® Plus 647

ZED-1227

HS-PEG24-CH2COOH

Genkwanin

Alkaline Phosphatase (Placental)/PLAP (Germ Cell Tumor Marker) Monoclonal Antibody (PL8-F6)

Tiaprost

Adiponectin receptor Polyclonal Antibody

6-Diazo-5-oxo-L-nor-Leucine

Acetyl-Histone H4 (Lys12) Polyclonal Antibody

Chembridge-5861528

ATR Recombinant Polyclonal Antibody (23HCLC)

Dihydroergotamine mesylate

ATP7B Monoclonal Antibody (3E10)

Tibenelast sodium

ATG7 Monoclonal Antibody (29CT10.3.12)

ZM241385

ATF4 Monoclonal Antibody ([N360A/24), PE

Tarloxotinib bromide

ASS1 Monoclonal Antibody (11F1)

Zoliflodacin

ARNTL Monoclonal Antibody (OTI1C11), TrueMAB™

Evans Blue

ARL6IP4 Polyclonal Antibody

AS2717638

ARHGDIA Monoclonal Antibody (OTI1A7), TrueMAB™

NoxA1ds TFA

AQP0 Polyclonal Antibody

Angiotensinogen (1-14), human TFA

ANGPTL1 Monoclonal Antibody (3A5)

QX-314 chloride

AMPK beta-1 Polyclonal Antibody

CHIKV-IN-2

ALPK1 Monoclonal Antibody (2B8B5)

1-Methyl-2-undecyl-4(1H)-quinolone

ALDH1A3 Monoclonal Antibody (OTI4B6)

Carboxyamidotriazole Orotate

ALDH18A1 Monoclonal Antibody (2B5)

Butyrolactone 3

AKR1C1 Polyclonal Antibody

Diethyl succinate

AIF Recombinant Rabbit Monoclonal Antibody (SZ05-01)

Cetrorelix Acetate

4 HNE Polyclonal Antibody

Propargyl-PEG3-alcohol

Ethyl phenylacetate

Amicarbazone

Amitriptyline Hydrochloride

Alkyne-PEG4-NHS

PFK-015

VAS-2870

Daun02

Thrombomodulin monoclonal antibody (Phx-01)

Amifostine thiol

Suc-Leu-Tyr-AMC

β-Elemonic acid

Rotenone

IgG4SP/Kappa Isotype Control

IgG1/Kappa Isotype Control

IgG1 / Kappa Isotype Control（MMAE）

Anti-LIV-1 / SLC39A6 Reference Antibody (ladiratuzumab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (opucolimab)

Anti-LAG3 / CD223 Reference Antibody (miptenalimab)

Anti-LAG3 / CD223 Reference Antibody (ieramilimab)

Anti-LAG3 / CD223 Reference Antibody (fianlimab)

Anti-LAG3 / CD223 Reference Antibody (favezelimab)

Anti-GLUT-1 Mouse mAb

Anti-LAG3 / CD223 Reference Antibody (encelimab)

Anti-EpCAM / TROP1 / CD326 Reference Antibody (oportuzumab)

Anti-LINGO1 Reference Antibody (opicinumab)

Anti-Integrin aVb3 (ITGAV & ITGB3) Reference Antibody (etaracizumab)

Anti-Integrin aV / ITGAV / CD51 Reference Antibody (intetumumab)

Anti-Integrin aV / ITGAV / CD51 Reference Antibody (abituzumab)

Anti-Integrin aL / ITGAL / CD11a Reference Antibody (efalizumab)

Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (BMS patent anti-Integrin α5β1)

Anti-Integrin a2b1 (ITGA2 & ITGB1) Reference Antibody (vatelizumab)

Anti-PCSK9 Reference Antibody (ongericimab)

Anti-Glucagon Rabbit mAb

Anti-IL-7Ra / CD127 Reference Antibody (PF-06342674)

Anti-B7-H3 / CD276 Reference Antibody (omburtamab)

Anti-IgE Reference Antibody (omalizumab)

Anti-IL-6 / IFNb2 Reference Antibody (olokizumab)

Anti-IL-6Ra / CD126 Reference Antibody (sapelizumab)

Anti-IL-6Ra / CD126 Reference Antibody (levilimab)

Anti-IL-6Ra / CD126 Reference Antibody (APX007)

Anti-IL-6 / IFNb2 Reference Antibody (ziltivekimab)

Anti-IL-6 / IFNb2 Reference Antibody (sirukumab)

Anti-IL-6 / IFNb2 Reference Antibody (siltuximab)

Anti-GFAP Rabbit mAb

Anti-VEGFR2 / KDR / CD309 Reference Antibody (olinvacimab)

Anti-IL-6 / IFNb2 Reference Antibody (Merck patent anti-IL-6)

Anti-IL-6 / IFNb2 Reference Antibody (MEDI 5117)

Anti-IL-6 / IFNb2 Reference Antibody (Medarex patent anti-IL-6)

Anti-IL-6 / IFNb2 Reference Antibody (CSTRI patent anti-IL-6)

Anti-IL-6 / IFNb2 Reference Antibody (Chugai SK2)

Anti-oxLDL Reference Antibody (Okayama U. patent anti-oxLDL)

Anti-IL-5 Reference Antibody (Abgenix anti-IL-5)

Anti-IL-4Ra / CD124 Reference Antibody (MEDI2045)

Anti-CD20 / MS4A1 Reference Antibody (ofatumumab)

Anti-GCDFP-15 Rabbit mAb

Anti-Annexin A1 Rabbit mAb

Anti-IL-33 Reference Antibody (itepekimab)

Anti-CD20 / MS4A1 Reference Antibody (ocrelizumab)

Anti-TIGIT Reference Antibody (ociperlimab)

Anti-CD20 / MS4A1 Reference Antibody (ocaratuzumab)

Anti-IL-2Ra / CD25 Reference Antibody (camidanlumAb)

Anti-IL-23a Reference Antibody (risankizumab)

Anti-IL-23 Reference Antibody (mirikizumab)

Anti-IL-23 Reference Antibody (LY2525623)

Anti-IL-23 Reference Antibody (brazikumab)

Anti-IL-21 Reference Antibody (avizakimab)

Anti-GATA3 Rabbit mAb

Anti-IL-20 Reference Antibody (Cheng Kung U. patent anti-IL-20)

Anti-IL-1RL1 / ST2 / IL-33R Reference Antibody (melrilimab)

Anti-F8 / Factor VIII Reference Antibody (Novo Nordisk patent anti-Factor VIII)

Anti-IL-1b Reference Antibody (CDP484)

Anti-IL-1a Reference Antibody (bermekimab)

Anti-IL-18 Reference Antibody (ABT-325)

Anti-IL-15 Reference Antibody (DISC0280)

Anti-PTPRC / CD45 Reference Antibody (Novartis patent anti-CD45)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nofazinlimab)

Anti-IL-13 Reference Antibody (M1295)

Anti-Galectin-3 Rabbit mAb

Anti-IL-13 Reference Antibody (lebrikizumab)

Anti-IL-13 Reference Antibody (IMA-026)

Anti-IL-13 Reference Antibody (H2L6)

Anti-IL-13 Reference Antibody (GSK 679586)

Anti-IL-13 Reference Antibody (dectrekumab)

Anti-IL-13 Reference Antibody (cendakimab)

Anti-IL-13 Reference Antibody (abrezekimab)

Anti-FcRn (FCGRT & B2M) Reference Antibody (nipocalimab)

Anti-IL-12 (IL-12a & IL-12b) Reference Antibody (briakinumab)

Anti-IL-10 Reference Antibody (BT-063)

Anti-FSH Mouse mAb

Anti-IGF-2 Reference Antibody (DX-2647)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (nimotuzumab)

Anti-Mesothelin Reference Antibody (NIH patent anti-Mesothelin)

Anti-IGF1R / CD221 Reference Antibody (ganitumab)

Anti-IGF1R / CD221 Reference Antibody (figitumumab)

Anti-TPBG Reference Antibody (naptumomAb)

Anti-IgE Reference Antibody (talizumab)

Anti-NT5E / CD73 Reference Antibody (mupadolimab)

Anti-IgE Reference Antibody (ligelizumab)

Anti-IgE (M1 prime) Reference Antibody (quilizumab)

Anti-FOXP1 Rabbit mAb

Anti-IFNg Reference Antibody (emapalumab)

Anti-IFNg Reference Antibody (AMG 811)

Anti-ICOS / CD278 Reference Antibody (MEDI-570)

Anti-ICAM1 / CD54 Reference Antibody (bersanlimab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (modotuximab)

Anti-B7-H3 / CD276 Reference Antibody (mirzotamab)

Anti-Amyloid Beta Reference Antibody (Merck anti-Amyloid beta 19.3)

Anti-HGFR / c-Met Reference Antibody (SAIT301)

Anti-HGFR / c-Met Reference Antibody (Metheresis patent anti-Met)

Anti-HGF / SF Reference Antibody (TAK-701)

Anti-FLI-1 Mouse mAb

Anti-KID3 Reference Antibody (Macrogenics patent anti-KID3)

Anti-Hepcidin / HAMP Reference Antibody (LY2787106)

Anti-Hepcidin / HAMP Reference Antibody (Ludwig-Maximilians U. anti_Hepsin)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (losatuxizumAb)

Anti-IGF1R / CD221 Reference Antibody (lonigutamab)

Anti-GPR64 / ADGRG2 Reference Antibody (Facet patent anti-GPR64)

Anti-CD19 Reference Antibody (Loncastuximab)

Anti-PCSK9 Reference Antibody (lodelcizumab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (lodapolimab)

Anti-TSPAN26 / CD37 Reference Antibody (lilotomab)

Anti-Fascin Mouse mAb

Anti-CD47 Reference Antibody (lemzoparlimab)

Anti-Sortilin / SORT1 Reference Antibody (latozinemab)

Anti-Amyloid Beta Reference Antibody (Kumamoto U. patent anti-Amyloid Beta)

Anti-HGFR / c-Met Reference Antibody (Korea RIBB patent anti-cMet)

Anti-TNFRSF18 / GITR / CD357 Reference Antibody (Korea Natl.Cancer Ctr. patent anti-GITR)

Anti-GD2 Reference Antibody (EMD 273063)

Anti-GD2 Reference Antibody (dinutuximab)

Anti-ERG Reference Antibody (Jackson Foundation patent anti-ERG)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (ivuxolimab)

Anti-FZD Reference Antibody (vantictumab)

Anti-ESA Mouse mAb

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (iparomlimab)

Anti-FOLH1 / PSMA Reference Antibody (pelgifatamAb)

Anti-Fibronectin Reference Antibody (radretumab)

Anti-TSPAN8 Reference Antibody (INSERM patent anti-CO-029)

Anti-FGFR1 / CD331 Reference Antibody (Lilly patent anti-FGFR-1)

Anti-DDR1 / CD167a Reference Antibody (Imperial College anti-DDR1)

Anti-IGF1R / CD221 Reference Antibody (Immunomedics patent anti-IGF-1R)

Anti- FcRH5 / IRTA2 / CD307e Reference Antibody (DFRF4539A)

Anti-FceR2 / CD23 Reference Antibody (lumiliximab)

Anti-F11 / Factor XI Reference Antibody (abelacimab)

Anti-ERG Rabbit mAb

Anti-CD19 Reference Antibody (Immunomedics hA19)

Anti-VEGFR2 / KDR / CD309 Reference Antibody (Imclone 6.64)

Anti-ERBB3 / HER3 Reference Antibody (lumretuzumab)

Anti-ERBB3 / HER3 Reference Antibody (barecetamab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (timigutuzumab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (margetuximab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Hersintuzumab)

Anti-EphA3 Reference Antibody (ifabotuzumab)

Anti-BTLA / CD272 Reference Antibody (icatolimab)

Anti-CD20 / MS4A1 Reference Antibody (ibritumomab)

Anti-ER-Beta Mouse mAb

Anti-ERBB1 / EGFR / HER1 Reference Antibody (zalutumumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Shanghai Cancer Inst patent anti-EGFRvIII)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (SerclutamAb)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (pimurutamab)

Anti-TNFSF2 / TNFa Reference Antibody (golimumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (necitumumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (matuzumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (laprituximab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (imgatuzumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Duke D2C7)

Anti-EpCAM / TROP1 / CD326 Mouse mAb

Anti-AMACR/p504s Mouse mAb

Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (demupitamab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Chinese Mil.Med.Sci. patent anti-EGFR)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (7A7)

Anti-TNFRSF5 / CD40 Reference Antibody (giloralimab)

Anti-IL-1b Reference Antibody (gevokizumab)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (geptanolimab)

Anti-Amyloid Beta Reference Antibody (Georgetown U. patent anti-Amyloid Beta)

Anti-EpCAM / TROP1 / CD326 Reference Antibody (adecatumumab)

Anti-NOTCH3 Reference Antibody (Genentech patent anti-Notch3)

Anti-MUC1 Mouse mAb

Anti-Complement Factor B Reference Antibody (Genentech patent anti-Factor B)

Anti-EGFL7 Reference Antibody (parsatuzumab)

Anti-MUC1 Reference Antibody (gatipotuzumab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (gancotamab)

Anti-DLL4 Reference Antibody (Smart Targeting patent anti-DLL4)

Anti-PCSK9 Reference Antibody (frovocimab)

Anti-TGFb1 Reference Antibody (fresolimumab)

Anti-TEM7R / PLXDC2 Reference Antibody (Fox Chase patent anti-TEM7R)

Anti-MUC17 Reference Antibody (Forerunner patent anti-Muc 17)

Anti-ICAM3 / CD50 Reference Antibody (Forerunner patent anti-ICAM-3)

Anti-ERBB1 / EGFR / HER1 Rabbit mAb

Anti-CXCR4 / CD184 Reference Antibody (Dana-Farber patent anti-CXCR4)

Anti-CD3e Reference Antibody (foralumab)

Anti-CXCL8 / IL-8 Reference Antibody (Genentech patent anti-IL-8)

Anti-CXCL8 / IL-8 Reference Antibody (ABX-IL8)

Anti-CXCL12 / SDF1a Reference Antibody (Genentech anti-CXCL12)

Anti-CXCL10 / IP-10 Reference Antibody (NI-0801)

Anti-IFNg Reference Antibody (fontolizumab)

Anti-CTLA-8 / IL-17a Reference Antibody (vunakizumab)

Anti-CTLA-8 / IL-17a Reference Antibody (UCB patent anti-IL-17)

Anti-CTLA-8 / IL-17a Reference Antibody (perakizumab)

Anti-CDH1 / E-cadherin / CD324 Mouse mAb

Anti-CTLA-8 / IL-17a Reference Antibody (netakimab)

Anti-CTLA-8 / IL-17a Reference Antibody (ixekizumab)

Anti-CTLA-8 / IL-17a Reference Antibody (CAT-2200)

Anti-CTLA-4 / CD152 Reference Antibody (zalifrelimab)

Anti-CTLA-4 / CD152 Reference Antibody (tremelimumab)

Anti-CTLA-4 / CD152 Reference Antibody (nurulimab)

Anti-TRP1 / TYRP1 Reference Antibody (flanvotumab)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (finotonlimab)

Anti-Sphingosine-1-phosphate Reference Antibody (Expression DD patent anti-SIP)

Anti-PCSK9 Reference Antibody (evolocumab)

Anti-DPC4 Rabbit mAb

Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (etrolizumab)

Anti-CSF2 / GM-CSF Reference Antibody (namilumab)

Anti-CSF2 / GM-CSF Reference Antibody (lenzilumab)

Anti-CSF2 / GM-CSF Reference Antibody (gimsilumab)

Anti-CSF1R / M-CSFR / CD115 Reference Antibody (LY3022855)

Anti-CSF1R / M-CSFR / CD115 Reference Antibody (emactuzumab)

Anti-TNFSF2 / TNFa Reference Antibody (Epitomics patent anti-TNFα)

Anti-Complement Factor D Reference Antibody (lampalizumab)

Anti-Complement C5aR1 Reference Antibody (G2 patent anti-C5aR)

Anti-DLL4 Reference Antibody (enoticumab)

Anti-ANO1 / TMEM16ARabbit mAb

Anti-Complement C5 Reference Antibody (ravulizumab)

Anti-Complement C5 Reference Antibody (lendalizumab)

Anti-AXL / UFO Reference Antibody (enapotamab)

Anti-CLEC4C Reference Antibody (LFB patent anti-BDCA-2)

Anti-CLEC4C Reference Antibody (BIIB059)

Anti-TNFRSF5 / CD40 Reference Antibody (Emory U. anti-CD40)

Anti-IL-6 / IFNb2 Reference Antibody (elsilimomab)

Anti-CEACAM6 / CD66c Reference Antibody (tinurilimab)

Anti-PCSK9 Reference Antibody (ebronucimab)

Anti-Desmin Mouse mAb

Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab)

Anti-IL-12b Reference Antibody (ebdarokimab)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (cergutuzumAb)

Anti-CEACAM1 / CD66a Reference Antibody (Chaim Sheba Med. Cntr. patent anti-CEACAM1)

Anti-CDH3 / P-cadherin Reference Antibody (PF-03732010)

Anti-CDH1 / E-cadherin / CD324 Reference Antibody (Stem Centrx patent anti-Cadherin-1)

Anti-CD9 Reference Antibody (Genentech patent anti-CD9)

Anti-CD83 Reference Antibody (Genentech patent anti-CD83)

Anti-CD79b Reference Antibody (iladatuzumAb)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (dostarlimab)

Anti-Cyclin D1 Rabbit mAb

Anti-CD7 Reference Antibody (grisnilimAb)

Anti-Amyloid Beta Reference Antibody (donanemab)

Anti-TIGIT Reference Antibody (domvanalimab)

Anti-CD59 Reference Antibody (Quark patent anti-CD59)

Anti-CD52 Reference Antibody (gatralimab)

Anti-FOLR1 / FRA Reference Antibody (Dompe patent anti-FOLR1)

Anti-VEGF Reference Antibody (Domantis patent anti-VEGF)

Anti-CD47 Reference Antibody (urabrelimab)

Anti-CD47 Reference Antibody (ligufalimab)

Anti-CD47 Reference Antibody (letaplimab)

Anti-COX-2 Rabbit mAb

Anti-CD20 / MS4A1 Reference Antibody (divozilimab)

Anti-Histone H1 Reference Antibody (derlotuximab)

Anti-IL-5 Reference Antibody (depemokimab)

Anti-CD4 Reference Antibody (TRX1)

Anti-CD4 Reference Antibody (tregalizumab)

Anti-CD4 Reference Antibody (ibalizumab)

Anti-CD38 Reference Antibody (mezagitamab)

Anti-CD38 Reference Antibody (isatuximab)

Anti-CD38 Reference Antibody (felzartamab)

Anti-CD34 Reference Antibody (ITRI patent anti-CD34)

Anti-Collagen Type IV Mouse mAb

Anti-CD3 Reference Antibody (visilizumab)

Anti-TNFSF5 / CD40L / CD154 Reference Antibody (dapirolizumab)

Anti-IGF1R / CD221 Reference Antibody (dalotuzumab)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (cudarolimab)

Anti-Complement C5 Reference Antibody (crovalimab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (cosibelimab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (coprelotamab)

Anti-CD28L / CD80 Reference Antibody (galiximab)

Anti-CD28 Reference Antibody (FR104)

Anti-CD20 / MS4A1 Reference Antibody (zuberitamab)

Anti-c-MYC Rabbit mAb

Anti-Alpha-1-Fetoprotein Rabbit mAb

Anti-CD20 / MS4A1 Reference Antibody (veltuzumab)

Anti-CD20 / MS4A1 Reference Antibody (ublituximab)

Anti-CD20 / MS4A1 Reference Antibody (TRU-015)

Anti-CD20 / MS4A1 Reference Antibody (ripertamab)

Anti-TFPI Reference Antibody (concizumab)

Anti-CD19 Reference Antibody (coltuximab)

Anti-PTK7 / CCK4 Reference Antibody (cofetuzumab)

Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (cobolimab)

Anti-TLR3 / CD283 Reference Antibody (CNTO5429)

Anti-IL-13 Reference Antibody (CNTO 607)

Anti-HGFR / c-Met Rabbit mAb

Anti-Amyloid Beta Reference Antibody (CNTO 2125)

Anti-IFNa1 Reference Antibody (Chinese CDC patent anti-Interferon Alpha)

Anti-CD2 Reference Antibody (siplizumab)

Anti-TNFSF2 / TNFa Reference Antibody (certolizumAb)

Anti-CD19 Reference Antibody (Duke U. patent anti-CD19)

Anti-IL-25 Reference Antibody (Centocor patent anti-IL-25)

Anti-CD19 Reference Antibody (denintuzumab)

Anti-EMMPRIN / CD147 Reference Antibody (Centocor patent anti-CD147)

Anti-CD151 Reference Antibody (Pierre Fabre patent anti-CD151)

Anti-CCL5 / RANTES Reference Antibody (NI-0701)

Anti-CK20 Rabbit mAb

Anti-CCL2 / MCP1 Reference Antibody (carlumab)

Anti-CB1 / CNR1 Reference Antibody (nimacimab)

Anti-ABCB5 Reference Antibody (Brigham and Women’s patent anti-ABCB5)

Anti-CALCA / CGRP Reference Antibody (galcanezumab)

Anti-CALCA / CGRP Reference Antibody (fremanezumab)

Anti-CALCA / CGRP Reference Antibody (eptinezumab)

Anti-PCSK9 Reference Antibody (Boehringer anti-PCSK9)

Anti-PCSK9 Reference Antibody (bococizumab)

Anti-SOST / Sclerostin Reference Antibody (blosozumab)

Anti-BACE1 Reference Antibody (Genentech anti-BACE1)

Anti-CK19 Rabbit mAb

Anti-B7-H4 / VTCN1 Reference Antibody (Millennium patent anti-B7-H4)

Anti-B7-H4 / VTCN1 Reference Antibody (alsevalimab)

Anti-B7-H3 / CD276 Reference Antibody (Trellis patent anti-B7-H3)

Anti-B7-H2 / ICOSL / CD275 Reference Antibody (prezalumab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sugemalimab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sudubrilimab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (pacmilimab)

Anti-DPP4 / CD26 Reference Antibody (begelomab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (manelimab)

Anti-TFPI Reference Antibody (befovacimab)

Anti-CK18 Rabbit mAb

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (garivulimab)

Anti-IFNa1 Reference Antibody (Baylor patent anti-IFN alpha)

Anti-FcRn (FCGRT & B2M) Reference Antibody (batoclimab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (adebrelimab)

Anti-AXL / UFO Reference Antibody (tilvestamab)

Anti-MSPR / RON / CD136 Reference Antibody (Aveo anti-RON)

Anti-Complement C5aR1 Reference Antibody (avdoralimab)

Anti-IL-1RL1 / ST2 / IL-33R Reference Antibody (astegolimab)

Anti-ANGPTL4 Reference Antibody (Nanyang Tech.U. patent anti-ANGPTL4)

Anti-ANGPT2 Reference Antibody (zansecimab)

Anti-CK17 Mouse mAb

Anti-GDF8 / Myostatin Reference Antibody (apitegromab)

Anti-ANGPT2 Reference Antibody (MEDI3617)

Anti-Amyloid Beta Reference Antibody (Amgen patent anti-beta amyloid)

Anti-ICOS / CD278 Reference Antibody (alomfilimab)

Anti-vWF Reference Antibody (Ajinomoto patent anti-vWF)

Anti-Amyloid Beta Reference Antibody (GSK 933776)

Anti-Cdiff Toxin A Reference Antibody (actoxumab)

Anti-Amyloid Beta Reference Antibody (gantenerumab)

Anti-ACVR2B Reference Antibody (Acceleron patent anti-ActRIIB)

Anti-Amyloid Beta Reference Antibody (DLX212)

Anti-CK14 Mouse mAb

Anti-Amyloid Beta Reference Antibody (crenezumab)

Anti-VEGFR1 / FLT1 Reference Antibody (Abbott patent anti-Flt1)

Anti-Amyloid Beta Reference Antibody (aducanumab)

Anti-Amyloid Alpha Reference Antibody (birtamimab)

Anti-MUC16 Reference Antibody (abagovomab)

Anti-TNFSF4 / OX40L / CD252 Reference Antibody (amlitelimab)

Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (abrilumab)

Anti-Siglec-3 / CD33 Reference Antibody (lintuzumAb)

Anti-TNFRSF5 / CD40 Reference Antibody (selicrelumab)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (drozitumab)

Anti-CK10 Mouse mAb

Anti-CCR5 / CD195 Reference Antibody (leronlimab)

Anti-TLR7 Reference Antibody (U.Tokyo patent anti-TLR7)

Anti-SCN11a / Nav1.9 Reference Antibody (Wuhan U. patent anti-Nav1.9)

Anti-CDH11 / Cadherin-11 Reference Antibody (RG6125)

Anti-TREM1 / CD354 Reference Antibody (PY159)

Anti-GFRA3 Reference Antibody (nadecnemab)

Anti-PAR2 Reference Antibody (PAR650097)

Anti-Complement C5 Reference Antibody (eculizumab)

Anti-MICA Reference Antibody (CLN-619)

Anti-MUSK Reference Antibody (Argenx patent anti-MuSK)

Anti-CK8 Mouse mAb

Anti-CD3e Reference Antibody (teplizumab)

Anti-CD59 Reference Antibody ( Mellitus patent anti-CD59)

Anti-TSHR Reference Antibody (K1-70)

Anti-KLK2 / Kallikrein 2 Reference Antibody (JNJ-69086420)

Anti-DSG3 Reference Antibody (Forerunner patent anti-DSG3)

Anti-IL-13 Reference Antibody (tralokinumab)

Anti-CTLA-8 / IL-17a Reference Antibody (secukinumab)

Anti-HLA-DR Reference Antibody (IMMU-114)

Anti-LYPD3 / C4.4A Reference Antibody (lupartumab)

Anti-SLAMF6 / CD352 Reference Antibody (SGN-CD352A)

Anti-CK7 Mouse mAb

Anti-NOTCH3 Reference Antibody (tarextumab)

Anti-SCFR / c-Kit / CD117 Reference Antibody (CDX-0158)

Anti-TNFSF7 / CD27L / CD70 Reference Antibody (cusatuzumab)

Anti-EFNA4 Reference Antibody (PF-06647263)

Anti-LAMP1 / CD107a Reference Antibody ( SAR428926)

Anti-SLITRK6 Reference Antibody (sirtratumab)

Anti-SLC44A4 Reference Antibody (ASG-5ME)

Anti-LRRC15 / LIB Reference Antibody (samrotamab)

Anti-ETBR Reference Antibody (DEDN6526A)

Anti- FcRH5 / IRTA2 / CD307e Reference Antibody (cevostamab)

Anti-CK (pan) Mouse mAb

Anti-ALK Mouse mAb

Anti-PRLR / Prolactin Receptor Reference Antibody (rolinsatamab)

Anti-GD3 Reference Antibody (ecromeximab)

Anti-Integrin a11 / ITAG11 Reference Antibody (Scripps patent anti-CD11a)

Anti-GPC1 / Glypican-1 Reference Antibody (Minomic patent anti-Glypican 1)

Anti-CD44v6 Reference Antibody (bivatuzumab)

Anti-DPEP3 Reference Antibody (tamrintamab)

Anti-MUC1 Reference Antibody (cantuzumab)

Anti-c-RET Reference Antibody (Regeneron patent anti-RET)

Anti-TMEFF1 / Tomoregulin-1 Reference Antibody (Bluefin patent anti-TMEFF1)

Anti-Dysadherin Reference Antibody (Centrose patent anti-dysadherin)

Anti-CK (LMW) Mouse mAb

Anti-158P1D7 Reference Antibody (Agensys patent anti-158P1D7)

Anti-PTGFRN / CD315 Reference Antibody (AG02-ADC)

Anti-MRC2 / CD280 Reference Antibody (Copenhagen Rigshospitalet patent anti-uPARAP)

Anti-Matriptase Reference Antibody (Oxford Bio patent anti-Matriptase)

Anti-TEM1 / Endosialin / CD248 Reference Antibody (ontuxizumab)

Anti-DLK1 Reference Antibody (LIV-1205)

Anti-PLAUR / uPAR / CD87 Reference Antibody (ATN-658)

Anti-CD98 Reference Antibody (KHK2898)

Anti-KAAG1 Reference Antibody (ADCT-901)

Anti-Ly6E Reference Antibody (RG7841)

Anti-CK (HMW) Mouse mAb

Anti-CD28 Reference Antibody (lulizumab)

Anti-IL-1b Reference Antibody (canakinumab)

Anti-CD163 Reference Antibody (OR2805)

Anti-TPBG Reference Antibody (PF-06263507)

Anti-HTRA1 Reference Antibody (FHTR2163)

Anti-CXC-ELR Reference Antibody (Lilly patent anti-Pan-ELR+)

Anti-ANGPTL8 Reference Antibody (Regeneron patent anti-ANGPTL8)

Anti-RG1 Reference Antibody (19G9)

Anti-Histone H4 Reference Antibody (Immunomedics patent anti-Histone H4)

Anti-Histone H3 Reference Antibody (Immunomedics patent anti-Histone H3)

Anti-Chromogranin Mouse mAb

Anti-Histone H2B Reference Antibody (Immunomedics patent anti-Histone H2B)

Anti-Integrin b7 / ITGB7 Reference Antibody (Genentech patent anti-Integrin β7)

Anti-SCN9a / Nav1.7 Reference Antibody (Duke anti-NAv1.7)

Anti-Polyubiquitin Reference Antibody (Genentech patent anti-Polyubiquitin)

Anti-ANO1 / TMEM16A Reference Antibody (Novartis patent anti-TMEM16A \t)

Anti-TIE2 / CD202b Reference Antibody (Regeneron patent anti-TIE-2)

Anti-TMEFF2 Reference Antibody (Janssen patent anti-TMEFF2)

Anti-STOP1 Reference Antibody (Genentech patent anti-STOP-1)

Anti-Albumin Reference Antibody (Numab patent anti-HSA)

Anti-GPR73 / PROKR1 Reference Antibody (Multiple seq-one in animal)

Anti-CEACAM5 / CEA / CD66e Mouse mAb

Anti-CXCL4 / PF4 Reference Antibody (U.Penn. patent anti-PF4)

Anti-SERPINE1 Reference Antibody (Sanofi patent anti-PAI-1)

Anti-Orai1 Reference Antibody (Amgen patent anti-ORAI1)

Anti-KLK5 / Kallikrein 5 Reference Antibody (Genentech patent anti-KLK5)

Anti-HGFA Reference Antibody (Genentech patent anti-HGFA\t)

Anti-TMPRSS2 Reference Antibody (Regeneron patent anti-TMPRSS2 \t)

Anti-TAT226 Reference Antibody (Genentech patent anti-TAT226)

Anti-RGMC / HFE2 Reference Antibody (DISC-0974)

Anti-Complement Factor P / Properdin Reference Antibody (Novelmed patent anti-Properdin)

Anti-PACAP38 Reference Antibody (Lilly patent anti-PACAP)

Anti-CDX-2 Rabbit mAb

Anti-Nogo Receptor / NgR Reference Antibody (Abbott patent anti-NGR)

Anti-Integrin b2 / ITGB2 / CD18 Reference Antibody (erlizumab)

Anti-GREM1 / Gremlin Reference Antibody (Regeneron patent anti-GREM1)

Anti-GOLM1 Reference Antibody (Cureab patent anti-GP73)

Anti-GPR44 / PTGDR2 / CD294 Reference Antibody (KHK patent anti-CRTH2)

Anti-TPSAB1 Reference Antibody (Genentech patent anti-Tryptase Beta 1)

Anti-MPL / TPOR / CD110 Reference Antibody (TA136)

Anti-CXCR3 / GPR9 / CD183 Reference Antibody (Genzyme patent anti-CXCR3)

Anti-vWF Reference Antibody (INSERM patent anti-vWF)

Anti-Sialyl-Lewis A Reference Antibody (MVT-5873)

Anti-CD163 Rabbit mAb

Anti-F9 / Factor IX Reference Antibody (emicizumab)

Anti-PTPRC / CD45 Reference Antibody (apamistamab)

Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab)

Anti-CD74 Reference Antibody (milatuzumab)

Anti-Integrin aVb6 (ITGAV & ITGB6) Reference Antibody (STX-100)

Anti-GUCY2C Reference Antibody (indusatumab)

Anti-ILDR2 Reference Antibody (bapotulimab)

Anti-IL-13Ra1 / CD213a1 Reference Antibody (MK-6105)

Anti-Phosphorylcholine Reference Antibody (ATH3G10)

Anti-GP6 / Glycoprotein-6 Reference Antibody (glenzocimab)

Anti-Syndecan-1 / CD138 Rabbit mAb

Anti-GFRAL Reference Antibody (NGM120)

Anti-CSF2Rb / CD131 Reference Antibody (CSL311)

Anti-C1q Reference Antibody (ANX005)

Anti-Adrenomedullin Reference Antibody (enibarcimab)

Anti-INHBA / Activin A Reference Antibody (garetosmab)

Anti-VEGFB Reference Antibody (CSL346)

Anti-Integrin b1 / ITGB1 / CD29 Reference Antibody (OS2966)

Anti-GPR20 Reference Antibody (DS-6157)

Anti-CSF3 / G-CSF Reference Antibody (CSL324)

Anti-Clusterin Reference Antibody (AB-16B5)

Anti-IL-3Ra / CD123 Mouse mAb

Anti-CD14 Reference Antibody (atibuclimab)

Anti-Complement C3 Reference Antibody (NGM621)

Anti-Complement C2 Reference Antibody (ARGX-117)

Anti-BTN1A1 Reference Antibody (CTX-2026)

Anti-IL-22Ra Reference Antibody (ARGX-112)

Anti-IFNAR1 Reference Antibody (anifrolumab)

Anti-Fucosyl GM1 Reference Antibody (BMS-986012)

Anti-FGF23 Reference Antibody (burosumab)

Anti-F12 / Factor XII Reference Antibody (garadacimab)

Anti-CALCRL / CGRPR Reference Antibody (erenumab)

Anti-Endoglin / CD105 Rabbit mAb

Anti-CB1 / CNR1 Reference Antibody (GFB-024)

Anti-TNFRSF13C / BAFFR / CD268 Reference Antibody (ianalumab)

Anti-Melanotransferrin / CD228 Reference Antibody (SC-005)

Anti-CD48 Reference Antibody (Regeneron patent anti-CD48)

Anti-Endoglin / CD105 Reference Antibody (carotuximab)

Anti-SLC1A5 / ASCT2 Reference Antibody (idactamab)

Anti-AMHR2 Reference Antibody (murlentamab)

Anti-ROBO1 Reference Antibody (Asclepius Technology patent anti-Robo1 CAR)

Anti-CD6 Reference Antibody (itolizumab)

Anti-FZD10 Reference Antibody (tabituximab)

Anti-CD99 Mouse mAb

Anti-ACTH Mouse mAb

Anti-CDH6 / K-Cadherin Reference Antibody (DS-6000a)

Anti-VEGFR1 / FLT1 Reference Antibody (icrucumab)

Anti-AOC3 / VAP1 Reference Antibody (timolumab)

Anti-TYRO3 Reference Antibody (ELB031)

Anti-TNFRSF12A / TWEAKR / CD266 Reference Antibody (enavatuzumab)

Anti-TROP2 Reference Antibody (sacituzumab)

Anti-TrkA / NTRK1 Reference Antibody (GBR 900)

Anti-TNFRSF10A / TRAILR1 / CD261 Reference Antibody ( mapatumumab)

Anti-TLR2 / CD282 Reference Antibody (tomaralimab)

Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (sabatolimab)

Anti-CD79a Rabbit mAb

Anti-TGFb1 Reference Antibody (M7824)

Anti-TGFb1 Reference Antibody (SRK181)

Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (tisotumab)

Anti-Tau Reference Antibody (semorinemab)

Anti-Tau Reference Antibody (gosuranemab)

Anti-Syndecan-1 / CD138 Reference Antibody (indatuximab)

Anti-STAB1 Reference Antibody (bexmarilimab)

Anti-SIRPg / CD172g Reference Antibody (KWAR23)

Anti-SIRPa / CD172a Reference Antibody (Hospital for Sick Children patent anti-SIRPA)

Anti-SEMA4D / CD100 Reference Antibody (pepinemab)

Anti-CD74 Rabbit mAb

Anti-SOST / Sclerostin Reference Antibody (romosozumab)

Anti-SOST / Sclerostin Reference Antibody (setrusumab)

Anti-RSPO3 Reference Antibody (rosmantuzumab)

Anti-RSPO1 Reference Antibody (Oncomed patent anti-RSPO1)

Anti-MSPR / RON / CD136 Reference Antibody (narnatumab)

Anti-TNFSF11 / RANKL / CD254 Reference Antibody (denosumab)

Anti-AGER / RAGE Reference Antibody (XT-M4)

Anti-PVRIG Reference Antibody (COM701)

Anti-PVRIG Reference Antibody (GSK4381562)

Anti-PSCA Reference Antibody (AGS-1C4D4)

Anti-Transferrin receptor / CD71 Rabbit mAb

Anti-PRAME Reference Antibody (Eureka patent anti-PRAME)

Anti-PLA2G1B Reference Antibody (Diaccurate patent anti-sPLA2-GIB)

Anti-PGLYRP1 / PGRP-S Reference Antibody (Novo Nordisk patent anti-PGLYRP1)

Anti-PDGFRB / CD140b Reference Antibody (rinucumab)

Anti-PDGFRA / CD140a Reference Antibody (olaratumab)

Anti-PDGFRA / CD140a Reference Antibody (tovetumab)

Anti-PDGFC / VEGFE Reference Antibody (Thrombogenics patent anti-PDGF-C)

Anti-PCSK9 Reference Antibody (alirocumab)

Anti-TNFSF4 / OX40L / CD252 Reference Antibody (oxelumab)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (tavolixizumab)

Anti-CD68 Rabbit mAb

Anti-NRP1 / VEGF165R / CD304 Reference Antibody (vesencumab)

Anti-NOTCH1 Reference Antibody (brontictuzumab)

Anti-RTN4 / NOGO Reference Antibody (ozanezumab)

Anti-NKG2A / CD94 Reference Antibody (monalizumab)

Anti-NGF / bNGF Reference Antibody (tanezumab)

Anti-NGF / bNGF Reference Antibody (fulranumab)

Anti-GDF8 / Myostatin Reference Antibody (trevogrumab)

Anti-GDF8 / Myostatin Reference Antibody (landogrozumab)

Anti-MUC16 Reference Antibody (sofituzumab)

Anti-MUC16 Reference Antibody (oregovomab)

Anti-CD63 Rabbit mAb

Anti-MUC1 Reference Antibody (clivatuzumab)

Anti-MU5AC Reference Antibody (ensituximab)

Anti-MMP9 Reference Antibody (andecaliximab)

Anti-MIF Reference Antibody (imalumab)

Anti-Mesothelin Reference Antibody (anetumab)

Anti-Mesothelin Reference Antibody (amatuximab)

Anti-MER / MERTK Reference Antibody (RGX-019)

Anti-MASP2 Reference Antibody (narsoplimab)

Anti-MAGEA3 Reference Antibody (CT Atlantic patent anti-MAGE-A3)

Anti-Siglec-4a / MAG Reference Antibody (refanezumab)

Anti-CD61 Rabbit mAb

Anti-MADCAM1 Reference Antibody (ontamalimab)

Anti-LOXL2 Reference Antibody (simtuzumab)

Anti-LILRB2 / ILT4 / CD85d Reference Antibody (JTX-8064)

Anti-Lewis Y Reference Antibody (MB 311)

Anti-LEPR / CD295 Reference Antibody (mibavademab)

Anti-LAP Reference Antibody (Brigham and Womens anti-LAP)

Anti-LAG3 / CD223 Reference Antibody (relatlimab)

Anti-KIR2DL1 / CD158a Reference Antibody (Innate patent anti-KIR2DL)

Anti-IL-9 Reference Antibody (enokizumab)

Anti-CXCL8 / IL-8 Reference Antibody (HuMax-IL8)

Anti-CD57 Mouse mAb

Anti-IL-7Ra / CD127 Reference Antibody (lusvertikimab)

Anti-IL-5Ra/ CD125 Reference Antibody (benralizumab)

Anti-IL-5 Reference Antibody (mepolizumab)

Anti-IL-4Ra / CD124 Reference Antibody (dupilumab)

Anti-IL-4 Reference Antibody (pascolizumab)

Anti-IL-33 Reference Antibody (etokimab)

Anti-IL-31Ra Reference Antibody (nemolizumab)

Anti-IL-2Ra / CD25 Reference Antibody (daclizumab)

Anti-IL-2Rb / CD122 Reference Antibody (Singapore ASTR patent anti-IL-2R beta / IL-2R gamma\t)

Anti-IL-23a Reference Antibody (tildrakizumab)

Anti-NCAM1 / CD56 Mouse mAb

Anti-IL-23 Reference Antibody (guselkumab)

Anti-IL-22 Reference Antibody (fezakinumab)

Anti-IL-20Ra Reference Antibody (Cheng Kung U. patent anti-IL-20R1)

Anti-IL-20 Reference Antibody (fletikumab)

Anti-IL-1RL2 / IL-36R Reference Antibody (imsidolimab)

Anti-IL-1RL2 / IL-36R Reference Antibody (spesolimab)

Anti-IL-1R1 / CD121a Reference Antibody (AMG 108)

Anti-IL-17c Reference Antibody (MOR106)

Anti-IL-13Ra2 / CD213a2 Reference Antibody (Wake Forest U. patent anti-IL-13RA2)

Anti-IL-13 Reference Antibody (anrukinzumab)

Anti-CD45RO Mouse mAb

Anti-IGF1R / CD221 Reference Antibody (teprotumumab)

Anti-IGF-1 Reference Antibody (xentuzumab)

Anti-IFNa1 Reference Antibody (sifalimumab)

Anti-IFNa1 Reference Antibody (rontalizumab)

Anti-IDO2 Reference Antibody (LIMR patent anti-IDO2)

Anti-ICOS / CD278 Reference Antibody (feladilimab)

Anti-ICOS / CD278 Reference Antibody (vopratelimab)

Anti-HGFR / c-Met Reference Antibody (emibetuzumab)

Anti-HGF / SF Reference Antibody (rilotumumab)

Anti-HGF / SF Reference Antibody (ficlatuzumab)

Anti-CD45R Mouse mAb

Anti-CD31 Mouse mAb

Anti-ERBB3 / HER3 Reference Antibody (seribantumab)

Anti-ERBB3 / HER3 Reference Antibody (patritumab)

Anti-HBEGF Reference Antibody (U3-1565)

Anti-HBEGF Reference Antibody (KHK2866)

Anti-Haptoglobin Reference Antibody (KHK patent anti-Haptoglobin)

Anti-GREM1 / Gremlin Reference Antibody (UCB patent anti-Gremlin-1)

Anti-GPRC5D Reference Antibody (talquetamab)

Anti-GPR49 / LGR5 Reference Antibody (petosemtamab)

Anti-GPR49 / LGR5 Reference Antibody (BNC101)

Anti-GPNMB Reference Antibody (glembatumumab)

Anti-PTPRC / CD45Rabbit mAb

Anti-GPA33 Reference Antibody (KRN330)

Anti-CSF2Ra / GM-CSFRa / CD116 Reference Antibody (mavrilimumab)

Anti-TNFRSF18 / GITR / CD357 Reference Antibody (ragifilimab)

Anti-GIPR Reference Antibody (Amgen patent anti-GIPR)

Anti-CSF3R / G-CSFR Reference Antibody (CSL patent anti-G-CSFR)

Anti-GCGR Reference Antibody (volagidemab)

Anti-GCGR Reference Antibody (crotedumab)

Anti-FZD7 Reference Antibody (U.Toronto patent anti-FZD7)

Anti-FLT3 / CD135 Reference Antibody (IMC-EB10)

Anti-Fibronectin Reference Antibody (L19-TNF)

Anti-CD44 Mouse mAb

Anti-FGFR4 / CD334 Reference Antibody (U3-1784)

Anti-FGFR3 / CD333 Reference Antibody (vofatamab)

Anti-FGFR3 / CD333 Reference Antibody (LY3076226)

Anti-FGF2 Reference Antibody (HuGAL-F2)

Anti-FGF19 Reference Antibody (1A6)

Anti-SLC40A1 Reference Antibody (Amgen patent anti-Ferroportin)

Anti-SLC40A1 Reference Antibody (LY2928057)

Anti-FAP Reference Antibody (sibrotuzumab)

Anti-EPOR Reference Antibody (Abbott patent anti-EPO Receptor)

Anti-EphB4 Reference Antibody (VasGene patent anti-EphB4)

Anti-CD43 Mouse mAb

Anti-EphB4 Reference Antibody (Morphosys patent anti-EphB4)

Anti-EphB2 Reference Antibody (Genentech patent anti-EphB2)

Anti-EpCAM / TROP1 / CD326 Reference Antibody (citatuzumab)

Anti-TNFRSF21 / DR6 / CD358 Reference Antibody (Abbvie patent anti-TNFRSF21)

Anti-DLL4 Reference Antibody (navicixizumab)

Anti-DLL4 Reference Antibody (demcizumab)

Anti-DKK1 Reference Antibody (BHQ-880)

Anti-CLEC7A Reference Antibody (Baylor patent anti-Dectin-1)

Anti-DC-SIGN / CD209 Reference Antibody (INSERM patent anti-DC-SIGN)

Anti-CXCR5 / CD185 Reference Antibody (SAR113244)

Anti-CD38 Rabbit mAb

Anti-CXCL9 Reference Antibody (Novimmune patent anti-CXCL9)

Anti-CXCL10 / IP-10 Reference Antibody (eldelumab)

Anti-CXADR Reference Antibody (Med. Bio. Labs patent anti-CXADR)

Anti-CSF1R / M-CSFR / CD115 Reference Antibody (cabiralizumab)

Anti-CRTAM / CD355 Reference Antibody (Oxford Bio patent anti-CRTAM)

Anti-CLEC14A Reference Antibody (Scripps Korea patent anti-CLEC14A)

Anti-CLEC12A / CD371 Reference Antibody (tepoditamab)

Anti-CLDN6 Reference Antibody (IMAB027)

Anti-CLDN18.2 Reference Antibody (zolbetuximab)

Anti-DCBLD2 / ESDN Reference Antibody (FA19-1)

Anti-CD35 Rabbit mAb

Anti-CCL20 Reference Antibody (GSK3050002)

Anti-CHI3L1 Reference Antibody (Brown U. patent anti-CHI3L1)

Anti-CEACAM6 / CD66c Reference Antibody (NEO-201)

Anti-CEACAM1 / CD66a Reference Antibody (CM-24)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab)

Anti-CDCP1 / CD318 Reference Antibody (U.California patent anti-CDCP1)

Anti-CD79b Reference Antibody (polatuzumab)

Anti-CD69 Reference Antibody (Genefrontier patent anti-CD69)

Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab)

Anti-CD52 Reference Antibody (alemtuzumab)

Anti-CD34 Mouse mAb

Anti-CD47 Reference Antibody (CC-90002)

Anti-CD47 Reference Antibody (magrolimab)

Anti-CD46 Reference Antibody (FOR46)

Anti-TNFRSF5 / CD40 Reference Antibody (dacetuzumab)

Anti-TNFRSF5 / CD40 Reference Antibody (sotigalimab)

Anti-TNFRSF5 / CD40 Reference Antibody (bleselumab)

Anti-ENTPD1 / CD39 Reference Antibody (TTX-030)

Anti-FcgR2a / CD32a Reference Antibody (VIB9600)

Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab)

Anti-IL-2Ra / CD25 Reference Antibody (basiliximab)

Anti-TNFRSF8 / CD30 Rabbit mAb

Anti-OX2R / CD200R1 Reference Antibody (Janssen patent anti-CD200R1)

Anti-CD200 Reference Antibody (samalizumab)

Anti-PROM1 / CD133 Reference Antibody (Forerunner patent anti-Prominin-1)

Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab)

Anti-IL-3Ra / CD123 Reference Antibody (SNG-CD123A)

Anti-SCFR / c-Kit / CD117 Reference Antibody (LOP628)

Anti-CCR7 / CD197 Reference Antibody (R707)

Anti-CCR4 / CD194 Reference Antibody (mogamulizumab)

Anti-CCR2 / CD192 Reference Antibody (plozalizumab)

Anti-CCL5 / RANTES Reference Antibody (VLST-002)

Anti-FceR2 / CD23 Mouse mAb

Anti-CTSS / Cathepsin S Reference Antibody (Fsn0503h)

Anti-CA9 / CAIX Reference Antibody (girentuximab)

Anti-CDH6 / K-Cadherin Reference Antibody (HKT288)

Anti-Complement C5aR1 Reference Antibody (G2_anti-C5aR)

Anti-C1s Reference Antibody (sutimlimab)

Anti-BST2 / CD317 Reference Antibody (XmAb 5592)

Anti-Klotho Beta Reference Antibody (NGM313)

Anti-Klotho Beta Reference Antibody (RG7992)

Anti-Bcl-2 Reference Antibody (U.Toronto patent anti-Bax)

Anti-TNFSF13B / BAFF / CD257 Reference Antibody (belimumab)

Anti-CD21 Rabbit mAb

Anti-B7-H6 / NCR3LG1 Reference Antibody (Dartmouth patent anti-B7-H6)

Anti-B7-H5 / VISTA Reference Antibody (onvatilimab)

Anti-B7-H3 / CD276 Reference Antibody (enoblituzumab)

Anti-TNFSF13 / APRIL / CD256 Reference Antibody (BION-1301)

Anti-Serum Amyloid P / SAP Reference Antibody (dezamizumab)

Anti-ANGPTL3 Reference Antibody (evinacumab)

Anti-ANGPT2 Reference Antibody (nesvacumab)

Anti-Alpha-synuclein Reference Antibody (prasinezumab)

Anti-Alpha-synuclein Reference Antibody (cinpanemab)

Anti-ACVRL1 / ALK-1 Reference Antibody (ascrinvacumab)

Anti-FcgR3a / CD16a Mouse mAb

Anti-CD19 Rabbit mAb

Anti-ALCAM / CD166 Reference Antibody (AT002)

Anti-ALCAM / CD166 Reference Antibody (praluzatamab)

Anti-ACVR2B Reference Antibody (bimagrumab)

Anti-ACVR2A Reference Antibody (Ab-14E1)

Anti-ACVR1 / ALK-2 Reference Antibody (DS-6016a)

Anti-TNFSF9 / 4-1BBL Reference Antibody (Abbvie patent anti-TNFSF9)

Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (urelumab)

Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (utomilumab)

Anti-VEGFR2 / KDR / CD309 Reference Antibody (ramucirumab)

Anti-VEGFA Reference Antibody (bevacizumab)

Anti-CD14 Rabbit mAb

Anti-TNFSF2 / TNFa Reference Antibody (infliximab)

Anti-TNFSF2 / TNFa Reference Antibody (adalimumab)

Anti-TIGIT Reference Antibody (tiragolumab)

Anti-SLAMF7 / CS1 Reference Antibody (elotuzumab)

Anti-Siglec-8 Reference Antibody (lirentelimab)

Anti-Siglec-15 / CD33L3 Reference Antibody (NC318)

Anti-ROR1 Reference Antibody (zilovertamab)

Anti-RGMA Reference Antibody (elezanumab)

Anti-FOLH1 / PSMA Reference Antibody (rosopatamab)

Anti-PSGL1 / CD162 Reference Antibody (neihulizumab)

Anti-CD13 Rabbit mAb

Anti-P-Selectin / CD62p Reference Antibody (crizanlizumab)

Anti-P-Selectin / CD62p Reference Antibody (inclacumab)

Anti-PMEL Reference Antibody (Novartis patent anti-PMEL17)

Anti-PMEL Reference Antibody (Genentech anti-PMEL17)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (durvalumab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (atezolizumab)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (MDX-1105)

Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (avelumab)

Anti-PDGFB Reference Antibody (MOR-8457)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nivolumab)

Anti-Neprilysin / CD10 Mouse mAb

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (pembrolizumab)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (camrelizumab)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (spartalizumab)

Anti-NT5E / CD73 Reference Antibody (oleclumab)

Anti-NKG2D / CD314 Reference Antibody (tesnatilimab)

Anti-Nectin-4 Reference Antibody (enfortumab)

Anti-CSF1 / M-CSF Reference Antibody (lacnotuzumab)

Anti-LILRB4 / ILT3 / CD85k Reference Antibody (U.Texas patent anti-LILRB4)

Anti-LILRB4 / ILT3 / CD85k Reference Antibody (Merck patent anti-ILT3 complex)

Anti-LIF Reference Antibody (MSC-1)

Anti-CD8 Mouse mAb

Anti-KIR3DL2 / CD158k Reference Antibody (lacutamab)

Anti-KIR Reference Antibody (lirilumab)

Anti-IL-6Ra / CD126 Reference Antibody (tocilizumab)

Anti-IL-6Ra / CD126 Reference Antibody (sarilumab)

Anti-IL-6Ra / CD126 Reference Antibody (vobarilizumab)

Anti-IL-6 / IFNb2 Reference Antibody (clazakizumab)

Anti-IL-21 Reference Antibody (Lilly patent anti-IL-21)

Anti-IL-1RAP / IL-1R3 Reference Antibody (nidanilimab)

Anti-IL-18 Reference Antibody (GSK 1070806)

Anti-IL-17Ra / CD217 Reference Antibody (brodalumab)

Anti-CD7 Mouse mAb

Anti-IL-15 Reference Antibody (ordesekimab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (pertuzumab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (trastuzumab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (zanidatamab)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (disitamab)

Anti-GPC3 / Glypican-3 Reference Antibody (codrituzumab)

Anti-FOLR1 / FRA Reference Antibody (mirvetuximab)

Anti-FOLR1 / FRA Reference Antibody (farletuzumab)

Anti-FGFR2 / CD332 Reference Antibody (aprutumab)

Anti-FGFR2 / CD332 Reference Antibody (bemarituzumab)

Anti-CD5 Rabbit mAb

Anti-FcRn (FCGRT & B2M) Reference Antibody (rozanolixizumab)

Anti-EphA2 Reference Antibody (Sanofi Aventis patent anti-EphA2)

Anti-EphA2 Reference Antibody (MEDI-547)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (cetuximab)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tigatuzumab)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (conatumumab)

Anti-DLL3 Reference Antibody (Dragonfly patent anti-DLL3)

Anti-DLL3 Reference Antibody (rovalpituzumab)

Anti-LY75 / CD205/DEC-205 Reference Antibody (CDX-1401)

Anti-LY75 / CD205/DEC-205 Reference Antibody (MEN1309)

Anti-CD4 Rabbit mAb

Anti-CXCR4 / CD184 Reference Antibody (ulocuplumab)

Anti-CX3CL1 / Fractalkine Reference Antibody (quetmolimab)

Anti-CTLA-4 / CD152 Reference Antibody (ipilimumab)

Anti-CCN2 / CTGF Reference Antibody (pamrevlumab)

Anti-HGFR / c-Met Reference Antibody (onartuzumab)

Anti-HGFR / c-Met Reference Antibody (telisotuzumab)

Anti-HGFR / c-Met Reference Antibody (amivantamab)

Anti-TNFSF7 / CD27L / CD70 Reference Antibody (vorsetuzumab)

Anti-CD7 Reference Antibody (Persongen patent anti-CD7)

Anti-CD5 Reference Antibody (Magenta patent anti-CD5)

Anti-CD2 Rabbit mAb

Anti-CD38 Reference Antibody (daratumumab)

Anti-TSPAN26 / CD37 Reference Antibody (naratuximab)

Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab)

Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab)

Anti-TNFRSF7 / CD27 Reference Antibody (varlilumab)

Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab)

Anti-IGF1R / CD221 Reference Antibody (cixutumumab)

Anti-CD20 / MS4A1 Reference Antibody (obinutuzumab)

Anti-CD20 / MS4A1 Reference Antibody (rituximab)

Anti-CD19 Reference Antibody (tafasitamab)

Anti-CD1a Mouse mAb

Anti-CD19 Reference Antibody (inebilizumab)

Anti-Spike S1 Reference Antibody (CR3022)

Anti-MERS Reference Antibody (D12)

Anti-MERS Reference Antibody (3A1)

Anti-MERS Reference Antibody (2E6)

Anti-SARS Reference Antibody (80R )

Anti-H3L Antibody (NAL_A185)

Anti-E8L Antibody (NL_A151)

Anti-Spike RBD (Omicron BA.2 / BA.2.75) Antibody (dAb-708)

Anti-Spike S1 (Omicron BA.2 / BA.2.75 / BA.4 / BA.5) Antibody (THS-699)

Anti-Calretinin Rabbit mAb

Anti-CD3d Rabbit mAb

Anti-Spike S1 Antibody (NCOV-S1P14-Fc)

Anti-Spike RBD Antibody (RP1-E4)

Anti-Spike RBD Antibody (RP1-H5)

Anti-Spike RBD Antibody (RP6-E2)

Anti-Spike RBD Antibody (RP6-E3)

Anti-CTLA-8 / IL-17a Antibody (SY18-VHH-11)

Anti-Spike RBD (Omicron) Antibody (P26130)

Anti-Spike RBD Antibody (R15-F7)

Anti-Nucleocapsid Antibody (N-P11)

Anti-Nucleocapsid Antibody (N-P10)

Anti-Calponin Mouse mAb

Anti-Spike RBD Antibody (R16-F10)

Anti-Spike RBD Antibody (R14-F8)

Anti-Nucleocapsid Antibody (N-18)

Anti-ACE2 Antibody (NCOV-7)

Anti-Nucleocapsid Antibody (N-9)

Anti-Spike RBD Antibody (P17-A11)

Anti-Spike RBD Antibody (P20-B4)

Anti-Spike RBD Antibody (P16-A3)

Anti-NSE Mouse mAb

Anti-HIF-1α Rabbit mAb

Anti-Caldesmon Rabbit mAb

Anti-Gastrin Rabbit mAb

Anti-CD99 Rabbit mAb

Anti-IL-3Ra / CD123 Rabbit mAb

Anti-ZAP-70 Rabbit mAb

Anti-WT1 Mouse mAb

Anti-VIP Mouse mAb

Anti-Vimentin Mouse mAb

Anti-Villin Rabbit mAb

Anti-VHL Mouse mAb

Anti-VEGFR2 / KDR / CD309Rabbit mAb

Anti-Calcitonin Rabbit mAb

Anti-Tyrosinase Mouse mAb

Anti-β-tubulin-III Mouse mAb

Anti-TTF-1 Mouse mAb

Anti-Tryptase Mouse mAb

Anti-TPO Mouse mAb

Anti-TOP2A Mouse mAb

Anti-TIA-1 Mouse mAb

Anti-TS Mouse mAb

Anti-Thyroid Stimulating Hormone Mouse mAb

Anti-TROP2Mouse mAb

Anti-CA9 / CAIXMouse mAb

Anti-Synaptophysin Mouse mAb

Anti-STAT6 Mouse mAb

Anti-SOX10 Mouse mAb

Anti-Somatostatin Mouse mAb

Anti-SMARCA4 / Brg1 Rabbit mAb

Anti-SMA Rabbit mAb

Anti-SDHA Mouse mAb

Anti-S100P Mouse mAb

Anti-FOLH1 / PSMA Mouse mAb

Anti-PSAP Rabbit mAb

Anti-C4d Mouse mAb

Anti-PSA Mouse mAb

Anti-Protein Gene Product 9.5 Mouse mAb

Anti-Podoplanin Mouse mAb

Anti-PMS2 Rabbit mAb

Anti-PLAP Mouse mAb

Anti-PCNA Rabbit mAb

Anti-Pax8 Rabbit mAb

Anti-Pax-5 Mouse mAb

Anti-p120 Rabbit mAb

Anti-p63 Rabbit mAb

Anti-BOB.1 Mouse mAb

Anti-p57 Mouse mAb

Anti-p27 Mouse mAb

Anti-p16 Mouse mAb

Anti-NSE Rabbit mAb

Anti-nm23 Mouse mAb

Anti-NGFR Mouse mAb

Anti-Neurofilament Rabbit mAb

Anti-NeuN Rabbit mAb

Anti-Nestin Mouse mAb

Anti-Napsin A Rabbit mAb

Anti-Bcl-6 Mouse mAb

Anti-Myoglobin Rabbit mAb

Anti-MyoD1 Rabbit mAb

Anti-Myeloperoxidase Mouse mAb

Anti-Myelin Basic Protein Rabbit mAb

Anti-MUM1 Rabbit mAb

Anti-RSV-F Reference Antibody (palivizumab)

Anti-RSV-F Reference Antibody (motavizumab)

Anti-Rabies virus GP Reference Antibody (rafivirumab)

Anti-Rabies virus GP Reference Antibody (foravirumab)

Anti-HBsAg Reference Antibody (OST 577)

Anti-CLDN6 Reference Antibody (IM-302)

Anti-MUC6 Mouse mAb

Anti-CLDN6 Reference Antibody (IM-301)

Anti-Shiga toxin (E.coli) Reference Antibody (setoxaximab)

Anti-Shiga toxin (E.coli) Reference Antibody (pritoxaximab)

Anti-Abm Reference Antibody ( IgG4+Kappa Isotype Control)

Anti-Abm Reference Antibody ( IgG1+Kappa Isotype Control)

Anti-LIV-1 / SLC39A6 Mouse Antibody

Anti-Tau Reference Antibody (A155)

Anti-Tau Reference Antibody (A119)

Anti-Tau Reference Antibody (A080)

Anti-Tau Reference Antibody (A105)

Anti-MUC5AC Mouse mAb

Anti-Tau Reference Antibody (A103)

Anti-Tau Reference Antibody (A054)

Anti-Tau Reference Antibody (pT217,rabbit IgG1)

Anti-Tau Reference Antibody (pT217,mouse IgG1)

Anti-Tau Reference Antibody (pT217,human IgG1)

Anti-Tau Reference Antibody (posdinemab)

Anti-Amyloid Beta Reference Antibody (Aβab002)

Anti-Amyloid Beta Reference Antibody (Aβab001)

Anti-TL1A Reference Antibody (PF-06480605)

Anti-TL1A Reference Antibody (PR200，5C3D11)

Anti-MUC2 Mouse mAb

Anti-MMAE

Anti-BSG2 / CD147 Reference Antibody (HcHAb18-DM1）

Anti-TL1A Reference Antibody (PR200，1D1)

Anti-CLDN18.2 Reference Antibody (zolbetuximab MMAE)

Anti-EGFR & Fc-gamma-RIIIA Reference Antibody (AFM24)

Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(huIgG1-rat IgG2b))

Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(mIgG2a-rat IgG2b))

Anti-CD3 & FCRL5 Reference Antibody (Cevostamab)

Anti-BAFF & IL-17A Reference Antibody (Tibulizumab)

Anti-CD3 & CD20 Reference Antibody (Epcoritamab)

Anti-MSH6 Rabbit mAb

Anti-CD3 & BCMA Reference Antibody (Teclistamab)

Anti-CD123 & CD3 Reference Antibody (Flotetuzumab)

Anti-GPRC5D & CD3 Reference Antibody (Talquetamab)

Anti-IL-1a & IL1b Reference Antibody (Lutikizumab)

Anti-TNFalpha & IL-17 Reference Antibody (ABT122)

Anti-ANG2 & VEGFA Reference Antibody (Vanucizumab)

Anti-ANG2 & VEGFA Reference Antibody (Faricimab)

Anti-CD137 & Her2 Reference Antibody (Cinrebafusp alfa)

Anti-LGR5 & EGFR Reference Antibody (Petosemtamab)

Anti-CanAg Reference Antibody (Cantuzumab)

Anti-MSH2 Rabbit mAb

Anti-EpCAM / TROP1 / CD326 Mouse mAb

Anti-ADAM9 Reference Antibody (Imgc936)

Anti-GPC2 / Glypican 2 Reference Antibody (Nih Patent Anti-Glypican-2)

Anti-MAGE-A4 Reference Antibody (Imc-C103C)

Anti-NAMPT Reference Antibody (Alt-100)

Anti-CD93 Reference Antibody (Dcby02)

Anti-SEZ6 Reference Antibody (Abbv-011)

Anti-TREM2 Reference Antibody (PY314)

Anti-ALP Reference Antibody (Seagen Patent Anti-Alpp)

Anti-SLC7A11 Reference Antibody (Agilvax Patent Anti-Slc7A11)

Anti-Meflin Reference Antibody (Tokai U. Patent Anti-Meflin)

Anti-MLH1 Rabbit mAb

Anti-CD36 Reference Antibody (Ona Thera Patent Anti-Cd36)

Anti-CD98 Reference Antibody (Ign523)

Anti-PVR / CD155 Reference Antibody (Ntx1088)

Anti-CDCP1 / CD318 Reference Antibody (38 E11)

Anti-MSPR / RON / CD136 Reference Antibody (H5B14)

Anti-Transferrin receptor / CD71 Reference Antibody (Jr-141)

Anti-Fc gamma R1 Reference Antibody (Medarex Patent Anti-Fc-Gamma-R1)

Anti-MRC2 / CD280 Reference Antibody (Quark Patent Anti-Endo180)

Anti-ENPP3 / CD203c Reference Antibody (Ags-16C3F)

Anti-TM4SF1 Reference Antibody (Beth Israel Patent Anti-TM4SF1)

Anti-MART-1/melan A Mouse mAb

Anti-ROR2 Reference Antibody (Ozuriftamab)

Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab)

Anti-TROP2 Reference Antibody (Datopotamab)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Serclutamab talirine)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Laprituximab emtansine)

Anti-MUC16 Reference Antibody (Sofituzumab vedotin)

Anti-SLITRK6 Reference Antibody (Sirtratumab vedotin)

Anti-TNFSF7 / CD27L / CD70 Reference Antibody (Vorsetuzumab mafodotin)

Anti-CD79b Reference Antibody (iladatuzumab vedotin)

Anti-CanAg Reference Antibody (Cantuzumab ravtansine)

Anti-Mammaglobin Mouse mAb

Anti-CanAg Reference Antibody (Cantuzumab mertansine)

Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab ozogamicin)

Anti-CD19 Reference Antibody (Loncastuximab tesirine)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab duocarmazine)

Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-MMAE)

Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab talirine)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (Cetuximab-MMAE)

Anti-ERBB3/ HER3 Reference Antibody (Patritumab deruxtecan)

Anti-FOLR1 / FRA Reference Antibody (mirvetuximab-MMAE)

Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)

Anti-LEF-1 Rabbit mAb

Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)

Anti-CA9 / CAIX Reference Antibody (girentuximab-MMAE)

Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab-MMAE)

Anti-MUC1 Reference Antibody (clivatuzumab-MMAE)

Anti-Endoglin / CD105 Reference Antibody (carotuximab-MMAE)

Anti-AMHR2 Reference Antibody (Murlentamab-MMAE)

Anti-MU5AC Reference Antibody (ensituximab-MMAE)

Anti-GD3 Reference Antibody (ecromeximab-MMAE)

Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)

Anti-FOLR1 / FRA Reference Antibody (farletuzumab-MMAE)

Anti-Langerin Rabbit mAb

Anti-FOLH1 / PSMA Reference Antibody (rosopatamab-MMAE)

Anti-FOLH1 / PSMA Reference Antibody (rosopatamab tetraxetan)

Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab-MMAE)

Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab mertansine)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab-MMAE)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab emtansine)

Anti-Mesothelin Reference Antibody (anetumab-MMAE)

Anti-Mesothelin Reference Antibody (anetumab ravtansine)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab-MMAE)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab ravtansine)

Anti-Lambda Mouse mAb

Anti-ALCAM / CD166 Reference Antibody (Praluzatamab-MMAE)

Anti-ALCAM/CD166 Reference Antibody (praluzatamab ravtansine)

Anti-FOLR1 / FRA Reference Antibody (Mirvetuximab soravtansine)

Anti-TROP2 Reference Antibody (datopotamab deruxtecan)

Anti-MUC16 Reference Antibody (oregovomab-MMAE)

Anti-ERBB3/ HER3 Reference Antibody (patritumab-MMAE)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab-MMAF)

Anti-ROR1 Reference Antibody (Zilovertamab vedotin)

Anti-Siglec-2 / CD22 Reference Antibody (Pinatuzumab vedotin)

Anti-ROR2 Reference Antibody (ozuriftamab vedotin)

Anti-Ksp Cadherin Rabbit mAb

Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab vedotin)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab govitecan)

Anti-GUCY2C Reference Antibody (Indusatumab vedotin)

Anti-GPNMB Reference Antibody (Glembatumumab vedotin)

Anti-CD19 Reference Antibody (denintuzumab-MMAF)

Anti-AXL / UFO Reference Antibody (Enapotamab vedotin)

Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (tisotumab vedotin)

Anti-CD79b Reference Antibody (Polatuzumab vedotin-piiq)

Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-CLM)

Anti-Siglec-3 / CD33 Reference Antibody (gemtuzumab-CLM)

Anti-Ki-67 Rabbit mAb

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Disitamab vedotin)

Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab vedotin)

Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab mafodotin)

Anti-LIV-1 / SLC39A6 Reference Antibody (Ladiratuzumab vedotin)

Anti-HGFR / c-Met Reference Antibody (Telisotuzumab vedotin)

Anti-Nectin-4 Reference Antibody (enfortumab vedotin-ejfv)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab deruxtecan)

Anti-CLDN6 Reference Antibody (AB1-11)

Anti-CLDN6 Reference Antibody (AB3-7)

Anti-CLDN6 Reference Antibody (64A)

Anti-Kappa Rabbit mAb

Anti-CLDN6 Reference Antibody (AE3-20)

Anti-CLDN6 Reference Antibody (DS-9606a)

Anti-CDH17 / Cadherin-17 Reference Antibody (PTA001_A4)

Anti-CDH17 / Cadherin-17 Reference Antibody (10C12)

Anti-SIRPa / CD172a Reference Antibody (BI 765063)

Anti-AXL / UFO Reference Antibody (Tilvestamab-MMAE)

Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)

Anti-TROP2 Reference Antibody (Sacituzumab govitecan)

Anti-GPC3 / Glypican-3 Reference Antibody (Codrituzumab-MMAE)

Anti-BTN1A1 Reference Antibody (ICT-01-N297A)

Anti-Insulin Mouse mAb

Anti-Bax Rabbit mAb

Anti-BTN1A1 Reference Antibody (ICT-01)

Anti-AA2AR / Adenosine A2aR Reference Antibody (3F6-9G5)

Molecular-cancer/content/12/1/Page 15 of200 M, then incubated for 1 h at 37 in

Etastasis of breast cancer cells by way of activating mTORC2/Akt/FOXO3a

Otypic variations. As opposed to genetic modifications of cell populations, there was small

Anti-TPBG Reference Antibody (ASN004)

Anti-TSLP Reference Antibody (tezepelumab)

Anti-TGFb1 Reference Antibody (Genzyme patent anti-TGF-β)

Anti-CD19 Reference Antibody (obexelimab)

Anti-IFNAR1 Reference Antibody (Medarex patent anti-IFNAR-1)

Anti-GD2 Reference Antibody (naxitamab)

Anti-CEACAM5 / CEA / CD66e Reference Antibody (Immunomedics patent anti-CEACAM5 (Class III))

Anti-CSF1R / M-CSFR / CD115 Reference Antibody (axatilimab)

Anti-INHAMouse mAb

Anti-GLP1R Reference Antibody (Centocor patent anti-GLP-1R)

N-acetylation needed for ERAD-L|We conclude that N-terminal acetylation of Der

In animals on both typical salt and high salt diets (21, 22). The

Confident, a forward selection process is employed exactly where essentially the most considerable

Anti-VEGF Reference Antibody (BioMab patent anti-VEGF)

Anti-ERBB2 / HER2 / CD340 Reference Antibody (BioMab patent anti-Her2)

Anti-CTLA-4 / CD152 Reference Antibody (Antitope patent anti-CTLA4)

Anti-Amyloid Beta Reference Antibody (lecanemab)

Anti-Amyloid Beta Reference Antibody (bapineuzumab)

Anti-VEGFR3 / FLT4 Reference Antibody (LY3022856)

Anti-VEGFR2 / KDR / CD309 Reference Antibody (vulinacimab)

Anti-VEGFR2 / KDR / CD309 Reference Antibody (AT001)

Anti-VEGFR2 / KDR / CD309 Reference Antibody (alacizumAb)

Anti-IMP3 Rabbit mAb

| www.plosone.orgtions, 240 mg/ml FPKc brought on 65.2062.34 cell viability loss, suggesting

Ites, and traumatic wounds. Arterial, venous, and diabetic leg ulcers Pressure

Anti-VEGFC Reference Antibody (VGX100)

Anti-VEGFA Reference Antibody (varisacumab)

Anti-VEGFA Reference Antibody (ranibizumab)

Anti-Tau Reference Antibody (zagotenemab)

Anti-VCAM1 / CD106 Reference Antibody (Hanwha patent anti-VCAM-1)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (vonlerizumab)

Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (volociximab)

Anti-TSPAN26 / CD37 Reference Antibody (AGS67E)

Anti-TSLP Reference Antibody (Schering patent anti-TSLP)

Anti-TrkB / NTRK2 Reference Antibody (Rinat patent anti-TrkB)

Sons largely agree involving estimates determined by OGs and those determined

Ggest that endogenous AA is usually a mediator advertising hypoxic vasoconstriction in

. 27. Boivin G, Lips P, Ott SM, et al. Contribution of raloxifene

Preclinical model on which cellular therapy for X-linked SCID was created

Assay, ARR18 induced an ARR5:LUC construct by about 50 inside the

(Miceli et al., 2009), we decided to investigate whether or not the P574S

Anti-IgM Mouse mAb

Anti-TPBG Reference Antibody (Wyeth patent anti-5T4)

Anti-Complement C5 Reference Antibody (vilobelimab)

Anti-TIGIT Reference Antibody (vibostolimab)

Anti-TNFSF5 / CD40L / CD154 Reference Antibody (ruplizumab)

Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (vedolizumab)

Anti-STEAP1 Reference Antibody (vandortuzumAb)

Anti-TNFSF2 / TNFa Reference Antibody (hMAK195)

Anti-TNFSF2 / TNFa Reference Antibody (ESBA 105)

Anti-TNFSF2 / TNFa Reference Antibody (CMAB008)

Lls have been cultured and cell lysates have been prepared for immunoblotting or

Enterococcus) were absent or in low abundance (i.e., , 1 of culturable

OnedFigure 12. 7KCh induces crucial ER tension markers and SA inhibits this

Velocity and amplitude (Bhat et al., 2001). These electrophysiological modifications are observed

S, respectively ( p 0.0001, Fig 1A and B, and Supporting Information and facts Fig

Anti-Amyloid Beta Reference Antibody (U.Zurich patent anti-Amyloid Beta)

Anti-IgG4 Rabbit mAb

Anti-TNFSF2 / TNFa Reference Antibody (CDP571)

Anti-TNFSF14 / LIGHT / CD258 Reference Antibody (SAR252067)

Anti-TNFSF13B / BAFF / CD257 Reference Antibody (tabalumab)

Anti-TNFSF13 / APRIL / CD256 Reference Antibody (sibeprenlimab)

Anti-MICB Reference Antibody (U.Washington patent anti-MICB)

Anti-GAD65 Reference Antibody (U.Washington patent anti-GAD65)

Anti-TNFSF1 / TNFb Reference Antibody (pateclizumab)

Anti-DCSTAMP Reference Antibody (U.Rochester patent anti-DC-STAMP)

Ints and stored in RNAlater (Invitrogen AM7020) for 24 h at four (for

Lishment of latent infection, gene expression is limited to a gene

Th TBSTween 0.1 and incubated using the acceptable horseradish peroxidase conjugated secondary

Ein bindJOURNAL OF BIOLOGICAL CHEMISTRYEXPERIMENTAL PROCEDURES Cells and Reagents–THP-1 (National Centre

LsonPagemeasurement noise in the CFSE information [241]. Fitting the model to T

Levels within the perinatal period, substantially increasing the preterm infant’s

Anti-TNFRSF5 / CD40 Reference Antibody (ravagalimab)

Anti-TNFRSF5 / CD40 Reference Antibody (mitazalimab)

Anti-IgG Mouse mAb

Anti-TNFRSF5 / CD40 Reference Antibody (lucatumumab)

Anti-TNFRSF5 / CD40 Reference Antibody (iscalimab)

Anti-Amyloid Beta Reference Antibody (U.Illinois scFv59)

Anti-IL-33 Reference Antibody (tozorakimab)

Anti-IL-33 Reference Antibody (torudokimab)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (BMS-986178)

Anti-PDCD1 / PD-1 / CD279 Reference Antibody (toripalimab)

To a reaction mixture containing 20 M of phenol red (sodium salt

Sport proteins whose expression is regulated by numerous environmental stimuli. They

Ogens typically resulting from inherent genetic difficulties, Niacin deficiency on the

Mpler (Chemical Data Systems, Oxford, PA, USA) attached to a PerkinElmer

Sidue within the equivalent position to Arg203. (MLK3 numbering) This group

Hanks buffer eliminate unbound mAbs and incubated on ice with 1 : 1000 dilution

Anti-CAPRIN1 Reference Antibody (Toray patent anti-Caprin-1)

Anti-ERBB1 / EGFR / HER1 Reference Antibody (tomuzotuximab)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (lexatumumab)

Anti-IgD Mouse mAb

Anti-TCR Reference Antibody (TOL101)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (benufutamab)

Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (TNX-832)

Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tilogotamab)

Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (Chugai patent anti-TF)

Anti-Tau Reference Antibody (tilavonemab)

Disruption by means of tight junction translocation and cytoskeletal reorganization inside the human

N enhanced risk of building subsequent autoimmune ailments (rheumatoid arthritis, multiple

Man renal cell carcinoma [24], and glioblastomas [17]. RPLPO and TBP also belonged

Ernally located polyester that is certainly becoming cleaved by the enzyme could

F8300DsarA and SF8300DsaeRS. Transcripts of each psma and RNAIII

Anti-CSF2 / GM-CSF Reference Antibody (Theraclone patent anti-GM-CSF)

Anti-Complement C5 Reference Antibody (tesidolumab)

Anti-TIGIT Reference Antibody (etigilimab)

Anti-TGM2 / Transglutaminase 2 Reference Antibody (zampilimab)

Anti-IDH-1 Mouse mAb

Anti-TGFb1 Reference Antibody (NIS793)

Anti-TFPI Reference Antibody (marstacimab)

Anti-Tenascin C Reference Antibody (tenatumomab)

Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (telazorlimab)

Anti-TCR Reference Antibody (NKTT320)

Answer (SK-5300, Vector Blue). They had been then incubated having a rabbit

Ce, a situation that impairs voltage control. To overcome this trouble

D DNA synthesis by blocking uridine transport, therefore, inhibiting the pyrimidine

Of HIC in any purification procedure presents two main challenges. In

Ophobic and charged residues could mediate the NLRP3 inflammasome assembly (28). Could

Nin-8 (CCK-8) (Degorter et al., 2012), suggesting that these amino acids are

Anti-TBFbR2 Reference Antibody (LY3022859)

Anti-PCSK9 Reference Antibody (tafolecimab)

Anti-Tau Reference Antibody (bepranemab)

Anti-Integrin a2b3 (ITGA2 & ITGB3) Reference Antibody (tadocizumab)

Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)

Anti-HSA Mouse mAb

Anti-Amyloid Beta Reference Antibody (solanezumab)

Anti-NaPi2b / SLC34A2 Reference Antibody (upifitamab)

Anti-SLC2A8 Reference Antibody (VB1-050)

Anti-SLAMF7 / CS1 Reference Antibody (PDL241)

The anti-tumor activity of 5-FU by apoptosis, inhibition of proliferation and

Ss could result in Fas-mediated apoptosis. Nonetheless, the JNK pathway is

Tively impacts cardiac glucose uptake and insulin sensitivity following ischemic injury

Mann et al., 2012) were decrease than reported in previous studies. Two

Onds sustaining the structures of your ECD linker domain along with the

G of sodium citrate in 1000 mL of DEPC-treated water. paraformaldehyde (PFA

Anti-SLAMF7 / CS1 Reference Antibody (azintuxizumAb)

Anti-Siglec-3 / CD33 Reference Antibody (IMGN779)

Anti-Siglec-2 / CD22 Reference Antibody (pinatuzumab)

Anti-Siglec-2 / CD22 Reference Antibody (NCI m972)

Anti-Siglec-2 / CD22 Reference Antibody (NCI m971)

Anti-Siglec-2 / CD22 Reference Antibody (epratuzumab)

Anti-HNF1 Beta Rabbit mAb

Anti-Siglec-15 / CD33L3 Reference Antibody (Medimmune patent anti-Siglec-15)

Anti-Siglec-15 / CD33L3 Reference Antibody (AB-25E9)

Anti-BST2 / CD317 Reference Antibody (SBI Biotech patent anti-BST2)

A schematic form a summary with the strongest baseline predictors of

Nmethylated, respectively (Zilberman et al., 2007). According to the information from Zilberman

Nditions, WT mice showed standard regenerating crypts (Figure 3D). Additional determination

The existing SP resistance based on quintuple mutations in Tanzania.in

In IL-1 production, therefore indicating its function in the production of

Taneously enhance even if assigned to placebo. These situations make it

Anti-S100A4 Reference Antibody (LK-1)

Anti-RTN4 / NOGO Reference Antibody (NG-101)

Anti-RTN4 / NOGO Reference Antibody (atinumab)

Anti-RHD / CD240d Reference Antibody (LFB Anti-RhD)

Anti-RAMP3 Reference Antibody (Medella patent anti-RAMP-3)

Anti-RHD / CD240d Reference Antibody (roledumab)

Anti-Amyloid Beta Reference Antibody (Rockefeller U. patent anti-Amyloid Beta)

Anti-PMELMouse mAb

Anti-ATRX Mouse mAb

Anti-Bcl-2 Mouse mAb

Atient has suffered from low progressive skeletal myopathy considering that childhood. Given that

N PFS by investigator assessment.* Univariate evaluation Baseline variable Therapy (lenalidomide

H before TGI, Total proteins have been isolated from the hippocampal CA

E finish receptor occupancy and degradation. Consequently, we investigated the results

Ent of spontaneous seizures after SEAuthor Manuscript Writer Manuscript Author Manuscript

Ells is induced throughout the early phase of CSFV infection, indicating

Seedlings beneath non-HS situations. The information had at the very least 3 biological

Samples were kept protected from light for 24 h at RT before

Pattern recognition molecules (PRMs) to their ligands, i.e., binding of

F protein crowders (A and B) Diffusion coefficients (A) and photos

Hich was accompanied by the reversal of EMT plus the suppression

Logy in Tg (PCSK9) mice indicates the lack of PCSK9 influences

The COVID-19 pandemic. Supplementary data to this short article is usually located

Inciple elements of ancestry applying data from select CpG web pages (32). To

Carrier 19 loved ones (SLC19) of transporters which conform to the significant facilitator

Enough to alleviate pain in OA, and opioids can create considerable

Or on the neurotransmitters. Nevertheless, even though the transmitter involved in

D in the DNA damage-induced, p53-dependent WIP1 transcript regulation. The

Vitro three.three. ADAR2 Prevents Hepatocyte from Lipid Accumulation In VitroTo investigate the

E high-quality evidence and standardized remedy, and the rate of utilization

Ting (WB) (Figure 4d, Figure S19, Supporting Data), which showed that

Against fruit rot pathogens under in vitro circumstances; (4) to assess the

Ier survival curves have been derived from the KM plotter database (http

In Figure 6, the sensory evaluation benefits abA 2 10.14 0.30effect on RC-SSP, though

Re AR and virulence genes, respectively. (A) Connections connections. Nodes in

Or predicting HVPG 12 mm Hg and hence could pretty predict the

He crucial point of TBI remedy. EA has an protective effect

D not proliferate for the duration of overnight culture, Raji cells slightly proliferated, and

D) AZD4547. Data are represented as a percentage .E.M.Figure

0 or 1 Accessible tumor tissue No prior therapy for sophisticated gastric/GEJ

three mg/ml) as substrates. A. xylosoxidans ATCC 27061 and P. aeruginosa ATCC

Level of ATPBonferr test: chi square = 34.587, df = three, p = 0.025). (C) Inside the

Ting Details: Appendix S2. NVivo 12 application (QSR International) was applied to

Ed making use of Byologic software (Protein Metrics Inc., San Carlos, CA), which

Y was performed in 1956, however the official transplant plan was only

N a multidimensional no cost power surface implicit of solvent coordinates primarily based

90).Fc Oglycosylation from human IgG usion glycoproteinsThe IgG Fc is a

Ing MBNL1 (Muscleblind Like Splicing Regulator 1) expression enhancers, and toxic RNA

On for eight weeks, the mastering and memory capacity of the mice

Ne ASCT and reserve it for progressive illness. Ultimately, although consolidation

In the PES minima. One example is, it was shown that [N

Ubchondral bone may behave as a disease-modifying role within the progression

N the presence of Ca2+ ions, alginate solutions can type gels

E variety; HTN = hypertension; HLD = hyperlipidemia; DM = Diabetes Mellitus; CAD = coronary

Processes due to the fact they may be distributed in many immuneresponsive cell subsets that

Shown by mean of triplicates EM (left y-axis; break indicates the

King status (under no circumstances; former; light; moderate and heavy) plus the poverty

Corresponding to Asn118 in XEEL. Most structural calcium residues have been found

Showed higher levels of proliferation and low background levels of apoptosis

Fluid environment situations was evaluated by due to the ploughing of

Ics, and fine targeting properties. This study focused at developing physically

The future, adequate amounts of purified MSCs has to be obtained [40, 41]. Nevertheless

Ferences in human and mouse cardiac electrophysiology, the mechanisms of intracellular

H the following therapeutic treatment possibilities: single dose IV oritavancin, dalbavancin

Atment (EOT) in nonresponders. Tumors of patients 002-10(12) and 005-11(14) displayed

Inside the very first 1, using the stepwise process, we determined the

Ens. Secondary endpoints had been thus objective response price (ORR), illness handle

Patient remained in remission until 2010. In June 2010 patient presented with fever

On to 0 MYH91676-1791 treated cells.by direct interaction with viral

M was utilised for MS acquisition in unfavorable ionization mode. The

Ne None None None 3 months just after ASCT 1.510 14.160 two.950 1.131 five.250 10.380 36.180 16.670 1.590 Reference values five.five 015 3.3 two.five 7 34 35 25 4.carbohydrate

Ation. The present work was performed by J-GZ in partial fulfillment

Housekeeping genes were synthesized and procured from Sigma Aldrich. Agarose gel

Holesterol, and LDL in sufferers with sufferers with hypercholesterolemia, compared with

The North American Association of Central Cancer Registries Hispanic Identification Algorithm

Group before DFT and also the imply MAP from the DFT- group

Ational imply to become stunted, underweight, or malnourished, respectively. Raw scores

OparticlesThe antiretroviral activities of EuCF-DTG and FA-EuCF-DTG nanoparticles were assessed in

Minority accrual to clinical trials have been published, the challenge remains

Lyzed making use of Kaplan eier model and Cox proportional hazards models. All

F the pregnant ladies in the study was 24.7 four.1 years, and number

On. 2016;38:9. von Meyenn F, Iurlaro M, Habibi E, Liu NQ, Salehzadeh-Yazdi

Tion 1:1000 (1 h, room temp.). The rinsings of probes in buffered NaCl

Nism underlying this abdominal pain . Hypersensitivity refers towards the enhanced sensation

S also led us to seek out that inhibiting ALDH1A3 led

Gents that induced a modify in pHi or [Ca2+]i, statistical

Swiftly induces muscle insulin resistance for glucose uptake by means of the activation

D endothelial cells) that we previously created from sorted CRC cell

On, deregulation of cell survival at the same time as proliferation, invasion and

Infection and lysis,191 antitumor immune response induction22,23 and acute vascular disruption.

Node metastasis had been considerable predictors of PFS. However both anti-p53 antibody

Ctivation in the STINGAugust 2017 Volume 91 Problem 16 e00535-17 jvi.asm.orgDeschamps

E have been walking at 15cm/s. The video photos had been recorded

S. In addition, protein spot 167 also belonged to this pattern in

Ory syncytial viruses, exportinsIntroduction: the Global Health ProblemViral respiratory illness (VRD

Doped or undoped, are applied to simulate the unique regional environments

Th or with no asthma [11]. Increasing proof points for the truth that

Herols, IU/kg Lauric acid [12:0] Myristic acid [14:0] Palmitic acid [16:0] Stearic acid

Sease in JHMV-infected mice, irrespective if transplanted with GFP-NPCs or handled

T HSCT. There have been no mismatches in the ABO blood groups.

In DMSO situations). Transient transfection siRNA and mimics. siRNA (MUC1, HIF

Erial clearance rates, increases neutrophil surface adhesion molecule expression, enhances neutrophil

Ells treated with recombinant VACVs was analyzed (Table two). We identified that

Thin 5 years and as much as 40 within ten years when compared with 20 years in

Patient security along with the advancement of Precision Medicine. This new study

Ct free-standing LbL films.Supplies 2013, six Figure 1. Chemical structure of poly(diallylamine-co-maleic

D blood cells within the urine. When visible it is termed

E with enhanced abiotic stress tolerance [59, 60]. The ONAC095-SRDX plants contained

Ere followed for 2 years to study the biological causes and functional

Act as an efficient inflammasome inducer just after their injection into mice.

Ous hemorrhage might have a number of etiologies, but manifest and occult trauma

SIRT1 protein and cytokines have been detected. All of the operations of transfection

Iating the self-association with the lysozyme variants into oligomeric species and

HCL-v situations showed simultaneous expression of CD5 and CD23. All 9 SMZL

Chlorinated biphenyls (PCBs) are within a category of persistent organic pollutants

Events (AEs) have been monitored throughout the study. Benefits: All enrolled patients

Testing and an alpha of 0.05 was made use of. A log-rank Mantel-Cox test

Rhinitis, and groups C (n = ten, asthma/rotatory handle) and D (n

To block autophagic flux. Next, dual therapy with CQ and WA

Formation in substituted the bands in 832 cm of =O groups and

Hemical profile of your animal groups is shown in Table 1. Mice

Of CD in nanomaterials can be applied to impart higher DTX

G beads had been applied in anti-ER or anti–tubulin antibodies. An anti-rabbit

2 (three) (four)In all four circumstances, the negative Gibbs energy of reaction values

Se re existence.Commented [AC2R1]: I rep one particular, just cropped

Equally blocked by either CB1 antagonist AM251 or CB2 antagonist SREqually blocked by either CB1

0.05). Regression analysis showed that SGR, FI, FE and PER quadratically responded

Twelve production fluid samples and each of the cloned sequences had been affiliated

H information point ( D). 1 Statistically important difference (P 0.005) involving the plasma

Ation of immunosuppression drugs, including Cyclophosphamide (CY), a chemotherapeutic agent that

Activity against the RET kinase; nevertheless, no selective RET inhibitors have

Dicated that the overall DCR was 27 (95 CI: 130 ) along with the median PFS

The Chinese Ministry of Overall health Grant (No. 2013ZX10003006).

E body of proof exists demonstrating that n-3 PUFAs can evoke

St graft survival (18.0 years) and greatest overall survival (23.two years) and most

Articles have been 800 nm. As a result, SN-38/NCs-A showed the most beneficial tumor accumulation

Giterm=RefSeq) and from expressed sequence tag (EST) contigs (://phrap.org

4] such as Myc . Guidelines advise a strict surveillance protocol [5] in APC

, and enhanced travel distances. Curcumin remarkably elevated platform crossing number and

2, P2Y4, and P2Y6 requires activation of calcium-related pathways, at some point

Y of illnesses, age distribution of population, geographic spread and availability

Rior to FOLFIRI in individuals previously treated with oxaliplatin-based chemotherapy,[9] theRior to FOLFIRI in sufferers

S had been produced.ORIGINAL RESEARCHInsight and Remedy Outcomes in Schizophrenia: Post-hocS were produced.ORIGINAL RESEARCHInsight and

R for Itr1 gene, qIcy2-F and qIcy2-R for IcyR for Itr1 gene, qIcy2-F and qIcy2-R

N at 4 . The Cathepsin B Protein Storage & Stability sedimented mitochondrial pellet was

Genome to make bait-IL-6R alpha Protein MedChemExpress reporter strains. A cDNA library was constructed fromGenome

The pH of TPP affects the electronegative potential on the moleculeThe pH of TPP affects

L phased-arrayed head coil. All participants were verbally instructed to stayL phased-arrayed head coil. All

Articles were 800 nm. Thus, SN-38/NCs-A IL-4, Human showed the most effective tumor accumulationArticles have

PASK IBA 3+ (IBA Streptavidin Magnetic Beads custom synthesis Lifesciences), pFRED143 (Ludwig et al., 1999);

Cations of individuals undergoing operations (1). Despite many researches and availability ofCations of individuals undergoing

As shown across species.18,23,24,79 The most prominent phenotype in pls3 KOAs shown across species.18,23,24,79 Probably

Gd-IgA1 than do the cells from HCs, concordantly with the serumGd-IgA1 than do the cells

Aling from human Serum Albumin/ALB Protein site breast cancer cells. Morin and MST-312 therapy inhibitedAling

Mice. Values are imply D and are normalized with respect toMice. Values are imply

Bsorption of Cy5 at 280 nm (0.05 sirtuininhibitorCy5 absorption at 650 nm), and byBsorption of

0.five M urea, 300 mM IgG4 Fc Protein Formulation imidazole, 0.1 rapigest (or Nonidet

. Enzyme histochemistry permitted to localize trypsin-like enzymes in T. absoluta L. Enzyme histochemistry permitted

Partial response; SD, steady disease; PD, progressive illness; PS, performance status.Partial response; SD, stable illness;

Itor12.two years and 80 had been female, 60 Caucasian, and 60

Ofrontal cortex/mPFC (BA 11/10) Suitable FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Proper

Containing EDTA-2Na (15 mL/kg), followed by centrifugation at 1000 g atContaining EDTA-2Na (15 mL/kg), followed

NaCl, 100 mM sodium acetate (pH 5.5) containing 1 mg/ml pronase, and 1 mgNaCl, one

YFIGURE 2. Gut function is improved in Tg mice given oral FTYYFIGURE two. Gut function

Ent NCDs/chronic illnesses.4. Frequent Outcomes of DIT and Risk ofEnt NCDs/chronic illnesses.four. Frequent Outcomes of

_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R:

Tor experiments indicating the involvement of p38 but not JAK2 inTor experiments indicating the involvement

Angerhans cells are skin-resident immune cells that associate closely with keratinocytesAngerhans cells are skin-resident immune

Lthough an undetectable viral level at week 4 or 12 is actually a excellentLthough an

Lar obligate pathogenic bacteria with similar developmental cycle and cell biologyLar obligate pathogenic bacteria with

Oral gyrus is situated amongst the anterior and posterior lateral portionOral gyrus is positioned between

Ly distinct (P0.05). There have been some probable explanations for these benefits.Ly distinct (P0.05). There

Olitinib but not Tofacinitib DKK-3 Protein site decreased ALDH+ lung cancer cells indicating theOlitinib but

Ve explored the link involving childhood Cadherin-11, Human (HEK293, His) trauma exposure, cancer remedy, dysregulationVe

Toxins and citrinin are mycotoxins made by fungi developing on uniqueToxins and citrinin are mycotoxins

N. Particularly, when categorized by MSKCC criteria,13 intermediate- and poor-risk patientsN. Especially, when categorized by

S in TF and TFRC genes in between analyzed groups of individuals.S in TF and

Revisiae prions. Very first, overexpression of Ctr4 as an YFP fusion resultedRevisiae prions. First, overexpression

Ra certain for SAD1 (16) failed to detect cross-reacting protein in proteinRa distinct for SAD1

Ence of three M UMP. The activity of your enzymes present inEnce of 3 M

At roughly equal proportions beneath basal culture situations (31). Also toAt about equal proportions beneath

G molecules in dM or uM, cells were permeabilized (Cytofix/CytopermG molecules in dM or uM,

N. Nat Cell Biol. 2012;14(12):1282sirtuininhibitor4. 57. Kong LN, Zuo PP, Mu LN. Nat Cell Biol.

H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Sade, G.H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.;

Ofrontal cortex/mPFC (BA 11/10) Proper FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Correct

Articles had been 800 nm. Therefore, SN-38/NCs-A showed the most effective tumor accumulationArticles had been

) was heated to 70 below Ar2 for 18 h. Just after cooling

Cantly in B6.TNF-/- mice over the course of illnessCantly in B6.TNF-/- mice over the course

Ponse towards the GFD; (2) measuring the effect of reintroducing gluten followingPonse for the GFD;

Ofrontal cortex/mPFC (BA 11/10) Right FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Suitable

Neously with 1 106 BE (2)-c cells followed by instant therapy with 5000 mgNeously with

Y was detected only in one particular pregnancy with pre-eclampsia and fetalY was detected only

At mimics the GTP-bound state in the protein (GTR1-Q65L) increases TORC1 activity during amino acid

Was observed in subpopulation of renal medullary cells which can be arrangedWas observed in subpopulation

Rectly and consequently stay prone to suffer from skinning injury more thanRectly and consequently stay

Is positioned downstream of H2 O2 to mediate H2 O2 -induced sarcKATP channel stimulation in

Ere obtainable for the deceased kids. Genetic testing also identified the exact same mutation in

E 1A) was adapted from previous work5,28. The chip was laser cut from acrylic sheets

Fter treatment of LPS-stimulated macrophages with the drug I-BET (40), expression ofFter remedy of LPS-stimulated

Al., 2013). However, muscle- or liver-specific deletion of SIRT3 GDF-11/BMP-11, Human (HEK293) didn't resultAl., 2013).

Altered, indicating the AITRL/TNFSF18 Trimer Protein Source presence of oxidative tension [18]. This effect was

Ctious Diseases, 2011, 204 Suppl three;S757?60. doi:10.1093/infdis/ jir296 pmid:21987747 35. Pan Y et al. Reston

Al cells [6]. This finding suggests that ECyd causes Vaults dysfunction preferentiallyAl cells [6]. This

Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting

Xpression didn't exhibit a important effect on all round survival (data not shown). To validate

Ncovered an inverse connection between the frequency of syntillas and amperometric ACTB Protein web events

Ors may perhaps TGF beta 2/TGFB2 Protein site present novel signifies for the remedy of

Ever making use of sugammadex in their everyday practice. Occasional use of sugammadexEver employing sugammadex

Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The

Is hydrogen bonded to water molecules by way of the ester and carboxy moieties, forming

Ive instances with water and subjected to TFA hydrolysis (two M final concentration) for three

Maturity. Bar=50 m. (C) SEM picture of mature OsAP65+/+ pollen grains. Bar=50 m. (D) A

Of inner sequence positions, they call for changes of standard RNA synthesisOf internal sequence positions,

Y with the residue as a criterion and enhanced its performance. Having said that, so

Vs glargine (n = 159) plus metformin (each arms) FBG: 8.1 vs 6.5 mmol/L (P

Ncubated with Alexa Fluor?488 fluorochrome-conjugated secondary antibody (Invitrogen, USA) in PBS, and had been then

Es relies on seemingly telomerespecific molecular pathways. Nevertheless, it appears thatEs relies on seemingly telomerespecific

Ain promoter activities in the root-hair zone. A strong and veryAin promoter activities in the

Em for three min, which was confirmed to be adequate for equilibration. The data are

Anosine pentaphosphate (pppGpp), accumulate beneath starvation circumstances (Chatterji and Ojha, 2001). On the one hand

Ovide additional information about the underlying causes of connected ailments, for example Hirschsprung's and OIBD1,14,17.

Copoeia, System II, a paddle strategy, was performed making use of a RCZ-Copoeia, Approach II,

Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The

Overexpressing cells. Fluorescence was excited employing the 488 nm line of the argon laser and

Ing aspect for AF. A Danish cohort study supports the observation in the Japanese study;

Ls. Discontinuations due to AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations because of AEs

Expression of its coding counterpart, AFAP1. Precise Inhibition of AFAP1-ASExpression of its coding counterpart, AFAP1.

Unctate staining was also visible in type II alveolar epithelial cells (figure 3E, F).DISCUSSION To

Ied from an Iranian population had C-shaped canals. Inside a study of Rahimi et al.

Ks post-infection. These benefits suggest a correlation among the lack of AQP4 and decreased generation

Copoeia, IFN-gamma Protein Species System II, a paddle strategy, was performed employing a RCZ-Copoeia, Technique

Wnt4 Protein MedChemExpress Sponding band images from the MEFs. MWAs. The cells were lysedSponding band

Immature granulocytes using the absence of granulocytic dysplasia, monocytosis, eosinophilia, and basophilia [1]. Further clinicopathologic

Bust analogue of mean, and IQR is actually a robust measure of variability; functionals which

ML) LDL-C5/HDL-C6 non-HDL-C/HDL-C 26.45 ?1.06 63.19 ?2.52 62.15 ?1.90 50.ten ?1.05 29.41 ?1.38 17.76 ?0.32

The Ca2 source. We demonstrate that the time course for suchThe Ca2 supply. We demonstrate

Channel modulators. J Biol Chem 275(47):36556?6561. 40. Durham WJ, et al. (2008) RyR1 S-nitrosylation underlies

Hanges underlying 6OHDA-mediated dysfunction (Figure 6C). The present findings demonstrated that (1) 6-OHDA quickly mTORC1

He 900 mM TEA-Cl maintained the osmotic balance and chloride concentration across the bilayer though

Nd 3 months following switching drugs. P 0.001, P = 0.006 in comparison with

Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and escalatingOrmin activates AMPK by inhibiting

N Yua,b, Young Eun Hana,b, Young-Sun Jia,b, Keunhee Ohc, Jong-Woo Sohna, Ajin Lima, Jae-Pyo Jeonb,

group2 substitutions from the combined group1234 substitutions (hSTINGgroup134) strongly diminished DMXAA activation, whereas loss of

Localization (73). Interestingly, the deletion from the LI domain abolished IFNGR1 capping and redistributed IFNGR1

Such because the beta cells on the pancreas) and non-self (this kind ofSuch as the

Ne hundred independent docking runs had been carried out for the disaccharide.Ne hundred independent docking

Accordance with the suggestions within the Guide for the Care and Use of Laboratory Animals

E hydroxylation within the heart, possible inhibitors using a documented history of cardiotoxicity have been

Nd/or decreased survival (Table 1) [63, 64, 66-69, 71-73]. New diagnostic methods are linking previously

Of ICH had been unique involving the review groups. These benefits couldOf ICH were distinct

Rnatant was recentrifuged at 16,000 g for 15 min, and also the pellets have beenRnatant

Actin, 1 l of cDNA template and the following specific primers had been made use

Any phenotypic alteration within the adipose tissue of Agtrap??mice below HF loading, and Agtrap??mice certainly

Ition of its metabolic end item calcium oxalate crystals in numerousItion of its metabolic end

Tic PME activity is itself post-translationally controlled by way of a 1 : 1 interaction

Munol 2011; 187: 2181?192. 23 Kline JN, Cowden JD, Hunninghake GW, Schutte BC, Watt JL,

At 10 kHz (Molecular Devices). Liquid junction potentials were calculated from the Clampex built-in JPCalcW

By environmental things, which includes siblings and care centers (15). The physical connection between the

Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter therapy of

Salvage pathway and hydroxykynurenine within the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside

Pe?probe targeting BCAR4 was designed and synthesized by Advanced Cell Diagnostics and detection of BCAR4

Ectra have been visualized employing Sparky (Goddard TD, Kneller DG, SPARKY3, University of California, San

N (Supplementary Fig. S4A at JXB on the web). To confirm that the male defect

N by proteolytic enzymes,9 these improve cancer cell's capability forN by proteolytic enzymes,9 these boost

Approaches just usually do not have the capacity to home-in on small features on the

Was consistent and much more than 60 . PK evaluation showed that TK900D and TK900E

Cells may perhaps be FP Agonist review present in our cultures; nevertheless, further testing would

Ition of its metabolic finish product calcium oxalate crystals in variousItion of its metabolic end

Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting

Ase by six hours, which was then maintained for at least 24 hours.Ase by six

Hanism underlying insulin resistance, diabetes, and P2X7 Receptor Antagonist supplier Cardiovascular disease? The prevalent soil

Nt using the observations in Figure 2 mercury exposure of B10.S mice resulted in important

Inactive, as analyzed by Northern blot hybridization (Figure 3C). The findingInactive, as analyzed by Northern

In w1118, dcerk1, sirt2, and dcerk1.Caspase 6 medchemexpress dsirt2 fly mitochondria. The amountIn w1118, dcerk1,

Ll has sufficient time to sense the gravity vector, as a result, sensing no weight

Dead from EBV may be embalmed (False) Right answers in parenthesis.Pre-workshop (n = 285)

Grams of EPA+DHA every day are suggested below a physician's care. Around 30 million folks

Interaction in between host cells and bacteria. Additionally, we demonstrate thatInteraction between host cells and

Sponding band photos from the MEFs. MWAs. The cells were lysedSponding band images from the

Hances airway fluid absorption. The net result is actually a reduction in airway surface liquid

Ration and clonogenic activity K-RAS mutation outcomes in constitutive K-RAS activity, as demonstrated by a

N common first-line regimen in PTCL; having said that, for probably the most frequentN standard

Wafosis Co., Tokyo, Japan). The Drosophila heads have been examined by scanningWafosis Co., Tokyo, Japan).

Topomer analysis. Right here, we present the initial broad mGluR5 drug analysis of ECM protein

Rface with the TT. The nominal CRU model includes a square 7 ?7 array of

T 67 dpi by a recovery phenotype associated having a high quantity of repressed transcripts,

And shRNA-expressing (Turbo-GFP ) cells had been sorted by a fluorescence-activated cell sorterAnd shRNA-expressing (Turbo-GFP

In w1118, dcerk1, sirt2, and dcerk1.dsirt2 fly mitochondria. The amountIn w1118, dcerk1, sirt2, and dcerk1.dsirt2

Em for three min, which was proven to be enough for equilibration. The information are

Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue fluid,

D pre-column. The wavelength was set at 230 nm with a flowD pre-column. The wavelength

With a T-DNA organisational structure conducive to effective integration of clonedHaving a T-DNA organisational structure

Tion. The mTOR pathway was over-activated in lal-/- ECs, and inhibition of mTOR in lal-/-

Btained with TNP-ATP as an antagonist. A317491 has no structural similarity to any on the

U et al.US FDA companion diagnostics co-development requirementan investigator-initiated trial (28) or previously undetected ALK

E and choose cargo. (v) PKCθ manufacturer autophagy receptors including p62 regulateE and select cargo.

Rnatant was recentrifuged at 16,000 g for 15 min, along with the pellets wereRnatant was

Ready from 8:two L:S could remain in dissolution medium but theReady from 8:two L:S could

Ivided into blank control group, model (H. pylori) group in which cells have been treated

Te-sex pheromonal odors: 6-OHDA lesions of DA terminals in this area abolished the hardwired preference

S described over was applied. RNA Interference and Northern Analysis. DeliveryS described above was utilized.

Al handle in excess of drug release. Photodegradable groups are used in the presence of

E to examine substantial parameter spaces to figure out how mGluR7 medchemexpress unique signalingE to

Mbrane association correlates using the assembly status and subunit composition ofMbrane association correlates with the

Ells/well) cultured for 24 h have been co-cultured with B16-F10 or iB16-shGCR cells (5.06105cells/well; pre-cultured

Isms are required to define potential treatments (e.g. by means of diet programIsms are essential

Decline is accounted for Caspase medchemexpress largely by a rise in state 4 respirationDecline is

Identified as pan-cancer mechanisms of response (PI Score .1.0; Step five). A subset in the

Erent concentrations (four, eight, 16 and 20 mg/ml). Following the emulsion was added into every

Detected a great deal larger amounts of Pb (two,20014,200 ng/g DW) in red and brown

Ced having a new media without GNODE, and cells had been returnedCed having a new

Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) 10:58-The Assessment of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013)

Amino acid deletion related with CdLS [1]. The level of rRNA inAmino acid deletion related

Inactive, as analyzed by Northern blot hybridization (Figure 3C). The gettingInactive, as analyzed by Northern

Or comparison, the levels of PEA measured two h immediately after single administration of URB597

Insulin lispro and insulin aspart.23 Other in vitro studies have also shown that insulin aspart

Tracer by injection or gavage is much more complicated than simple incubation with ROS probes.

Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter treatment of

Thanol. For Western blotting, mouse anti-DDK antibody (OriGene) was made use of atThanol. For Western

Fore, the probability that the NPY Y5 receptor Formulation nasopharyngeal carcinoma within this patient was

Rome, this will incredibly probably influence clinical practice and inform investigators concerning the pathogenesis of

He manufacturer's directions (R D Systems, Minneapolis, Minnesota). Therapy with cathepsin-B inhibitor CA-074. CA-074 (L-3-trans(Propylcarbamoyl)oxirane-2-carbonyl)-L-isoleucyl-L-proline)

Chemotherapy at an earlier time point. Future prospective research are warrantedChemotherapy at an earlier time

Ncorporation, normalized to empty vector or nontargeted shRNA management lines. PNcorporation, normalized to empty vector

Ion of aggrecan and collagen II, though increasing production of collagen I [Mayne et al.,

Mg/ml) for 3 h at 37 1C. After derivation, iPSCs had been initially grown on

Ividual shown in Fig. 3).British Journal of NutritionDiscussionOur interest in dietary lactose as an immunomodulatory

E basic amino acid permease Gap1, on which TORC1-dependent, RspE general amino acid permease Gap1,

Sis.Evidence-Based Complementary and Option Medicine utilised as inhibitors. The finalSis.Evidence-Based Complementary and Alternative Medicine utilised

Nd: C, 70.89; H, 5.26; N, five.57.NoteASSOCIATED CONTENTS Supporting InformationNMR spectra and crystallographic information.

Creased age [20-22]. Similarly, within the present study, the youngest age groups had the highest

S having Langerhans cell histiocytosis and acquired chemotherapy [138]. Salmonella infection wasS acquiring Langerhans cell

Operties of this molecule, brief half-life, and poor MEK1 site bioavailability make itOperties of this

Centration-response curves for ET-1 showed enhanced strain generation in the course of isometric vascular smooth

Er (Fig. 9A). IK-1 also failed in reporter assays to inhibit R-mediated activation of the

E created for each and every gene for amplification of promoter and IP Antagonist list

He second generation. Conclusions: Thinking of the direct and maternal effects ofHe second generation. Conclusions:

H di-tert-butyldiaziridinone (1) and Pd(PPh3)4 led to a novel ErbB2/HER2 Formulation sequential allylicH di-tert-butyldiaziridinone (1)

Amide in ameliorating attacks of weakness in HypoPP and hyperkalaemic periodic paralysis will not be

Depth analyses of sulfatases of unknown function that had been identified in a genome-wide look

And these proteins synergistically amplified LPS-inducible Edn1 CD40 Inhibitor custom synthesis promoter activity (Fig. 8A).

Systemic LPS-induced inflammation, JQ1 increases the susceptibility to DSS-induced colitis.DISCUSSIONTheSystemic LPS-induced inflammation, JQ1 increases the

In relation to NST complexes have been obtained based on the MDIn relation to NST

Ar profile. However, broad adoption of this method has been hindered by an incomplete understanding

E patterns were supported by image analyses applying GIS [44] and Daime [32,45] programs and

Ranial hypertension. Outcomes are provided as medians (IQR).Abbreviations CT: computedRanial hypertension. Results are given as

Ordingly, fiber bridges have been explicitly placed on this plane using aOrdingly, fiber bridges have

O respond to TAM. Chrisholm et al. also showed cytotoxic effects of EGCG alone in

By contaminated mice was examined employing an experimental strategy described byBy contaminated mice was tested

Salvage pathway and hydroxykynurenine inside the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside

D the consequence of preincubation together with the fibril modulators, fluorescence anisotropy of PC/PG (1:1)

Nsgene expression, the severity from the condition in PD-1 Tg miceNsgene expression, the severity of

Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) ten:58-The Review of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013)

Ocols. Proteins have been separated on 4-15 gradient sodium dodecyl sulfate (SDS)-polyacrylamide gels and

Entation points towards the importance of sustaining the health with the axonal compartment. Whilst it

By the strategy of Bradford,40 Estrogen receptor drug utilizing bovine serum albumin (BSA) asBy the

Nduces AMPK activation in pancreatic -cells, which results in an increase in KATP channel trafficking

Tility [57]. They cause membrane rupture by stimulatingPLOS A single | plosone.orgthe ECM remodelling PPARβ/δ

Dothelial cell monolayer integrity and barrier properties by means of paracrine signaling mechanismsDothelial cell monolayer

On might be an essential aspect within this metabolic reprogramming (KimOn may very well be

Hat these effects happen as a consequence of various, metformin-induced adjustments in signaling each upstream

Erefore, mixture therapy with milrinone and low-dose landiolol may possibly be aErefore, combination therapy with

Pure water at reflux for 24 h effected clean hydrolysis of yourPure water at reflux

E experiments is located in Supporting Data. In experiments on NO/nitrite release from BChE manufacturer

Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction within the

Ssion construct we observed that PTEN is often a direct target ofSsion construct we observed

Pure water at reflux for 24 h effected clean hydrolysis in thePure water at reflux

Ginkgolides

Author: Ubiquitin Ligase- ubiquitin-ligase

Related Posts