January 8, 2021

Ster mix (Applied Biosystems, Foster City, CA; 4309155) having a real-time PCR instrument (Applied Biosystems, 7200). The sequences of primers were as follows (five to 3)40: CaV1.1-forward: GTTACATGAGCTGGATCACACAG; CaV1.1-reverse: ATGAGCATTTCGA-TGGTGAAG;…

Et al. BMC Genomics 2014, 15:159 http:www.biomedcentral.com1471-216415Page 13 ofDSA performed the microarray hybridization evaluation. DSA conceived in the study, participated in its design and coordination and helped to draft the…