Normalization control. After 48 h, HepG2 cells were stained using the b-Galactosidase

Normalization control. After 48 h, HepG2 cells were stained using the b-Galactosidase Staining Kit (Beyotime Institute of Biotechnology). For the secretory Gaussia princeps luciferase (Gluc) assay, the same procedure was used but pAAV-lacZ was replaced with pCMV-Gluc. 48 h post transfection, the culture supernatants wereStatistical analysisThe data presented here were expressed as mean 6 standard deviation (SD) and statistical significance was determined by the Student’s t test or two-way ANOVA. P-values are indicated by asterisks (***P,0.001, **P,0.01, *P,0.05).A Robust shRNA System Used for RNA InterferenceSupporting InformationFigure S1 The effects of stem structures on shRNA silencing activity. The antisense-sense (AS) shRNAs and the sense-antisense (SA) shRNAs were compared with each other for their anti-HBV activity. The HBV target sequences “GGUAUGUUGCCCGUUUGUCCU” (1856) and “CACUGUUUGGCUUUCAGUUAU” (2116) were used in (A) and (B) respectively. (TIF) Figure S2 Transfection with shRNA vector AS139 inhibited HBV pc/pgRNA dose-dependently. Primers HBVF (CGTTTTTGCCTTCTGACTTCTTTC) and HBVR (ATAAGATAGGGGCATTTGGTGGTC) were used for HBV pc/ pgRNA amplification. Lane 1, pshOK-basic:pHBV1.31 = 1:1; lane 2, pshOK-neg:pHBV1.31 = 1:1; lane 3, pshOK-neg:AS139: pHBV1.31 = 3:1:4; lane 4, pshOK-neg:AS139: pHBV1.31 = 1:1:2; lane 5, AS139: pHBV1.31 = 1:1. (TIF) Figure S3 Transfection with shRNA vector AS139 inhibited HBeAg antigen dose-dependently. HepG2 cells were seeded in 24-well plates and cotransfected with 200 ng of pHBV1.31, 200 ng shRNA plasmid (AS139 plus neg) and 100 ng pSEAP2-Control per well. The HBsAg and HBeAg concentrations in cell supernatants were detected 48 h post transfection. Means and standard deviations were Gracillin web generated from 3 independent experiments. (TIF) Figure S4 This pshOK shRNA system was comparedtarget sequence “UCUGUUUGCCCUGAUCUGCAU” were used in (A) and (B) respectively. Statistical significance was determined by comparing to shRNAs groups AS1856 and ASGluc-1 respectively. (TIF)Figure S5 Transfection with shRNA vectors didn’t induce an obvious interferon response. Lane 1, mock; lane 2, IFNa-2a; lane 3, AS139; lane 4, AS1819; lane 5, AS3172; lane 6, neg. (TIF) Figure S6 An indirect experiment using the 3′-UTR luciferase assay to demonstrate that these shRNAs were expressed. The relative luciferase level of AS139-1819-3172 was compared with AS139, AS1819 and AS3172 respectively. 18325633 (TIF) Figure S7 The co-transfected multiple shRNA constructs had better silencing activity than the shRNA plasmid with multiple shRNAs when the same amount of each shRNA scaffold was used. (TIF) Data SThe typical sequencing data covering the shRNA expression element, the full pshOK-basic plasmid sequence and their alignment file. (ZIP)Author ContributionsConceived and designed the experiments: XJW SQW. Performed the experiments: XJW YL HH XJZ PWX WH DDL. Analyzed the data: XJW YL SQW. Wrote the paper: XJW SQW.with the popular used vector pSuper. The HBV target sequence “GGUAUGUUGCCCGUUUGUCCU” and the Gluc
The Notch pathway is evolutionarily conserved with an important role in the processes such as cell proliferation, cell fate decision, differentiation and stem cell maintenance. Due to its fundamental role in stem cells[1], it has been speculated during the recent years that Notch SPDB family may have critical functions in cancer stem cells or cancer cells with a stem cell phenotype, therefore playing an important role in the process of epitheli.Normalization control. After 48 h, HepG2 cells were stained using the b-Galactosidase Staining Kit (Beyotime Institute of Biotechnology). For the secretory Gaussia princeps luciferase (Gluc) assay, the same procedure was used but pAAV-lacZ was replaced with pCMV-Gluc. 48 h post transfection, the culture supernatants wereStatistical analysisThe data presented here were expressed as mean 6 standard deviation (SD) and statistical significance was determined by the Student’s t test or two-way ANOVA. P-values are indicated by asterisks (***P,0.001, **P,0.01, *P,0.05).A Robust shRNA System Used for RNA InterferenceSupporting InformationFigure S1 The effects of stem structures on shRNA silencing activity. The antisense-sense (AS) shRNAs and the sense-antisense (SA) shRNAs were compared with each other for their anti-HBV activity. The HBV target sequences “GGUAUGUUGCCCGUUUGUCCU” (1856) and “CACUGUUUGGCUUUCAGUUAU” (2116) were used in (A) and (B) respectively. (TIF) Figure S2 Transfection with shRNA vector AS139 inhibited HBV pc/pgRNA dose-dependently. Primers HBVF (CGTTTTTGCCTTCTGACTTCTTTC) and HBVR (ATAAGATAGGGGCATTTGGTGGTC) were used for HBV pc/ pgRNA amplification. Lane 1, pshOK-basic:pHBV1.31 = 1:1; lane 2, pshOK-neg:pHBV1.31 = 1:1; lane 3, pshOK-neg:AS139: pHBV1.31 = 3:1:4; lane 4, pshOK-neg:AS139: pHBV1.31 = 1:1:2; lane 5, AS139: pHBV1.31 = 1:1. (TIF) Figure S3 Transfection with shRNA vector AS139 inhibited HBeAg antigen dose-dependently. HepG2 cells were seeded in 24-well plates and cotransfected with 200 ng of pHBV1.31, 200 ng shRNA plasmid (AS139 plus neg) and 100 ng pSEAP2-Control per well. The HBsAg and HBeAg concentrations in cell supernatants were detected 48 h post transfection. Means and standard deviations were generated from 3 independent experiments. (TIF) Figure S4 This pshOK shRNA system was comparedtarget sequence “UCUGUUUGCCCUGAUCUGCAU” were used in (A) and (B) respectively. Statistical significance was determined by comparing to shRNAs groups AS1856 and ASGluc-1 respectively. (TIF)Figure S5 Transfection with shRNA vectors didn’t induce an obvious interferon response. Lane 1, mock; lane 2, IFNa-2a; lane 3, AS139; lane 4, AS1819; lane 5, AS3172; lane 6, neg. (TIF) Figure S6 An indirect experiment using the 3′-UTR luciferase assay to demonstrate that these shRNAs were expressed. The relative luciferase level of AS139-1819-3172 was compared with AS139, AS1819 and AS3172 respectively. 18325633 (TIF) Figure S7 The co-transfected multiple shRNA constructs had better silencing activity than the shRNA plasmid with multiple shRNAs when the same amount of each shRNA scaffold was used. (TIF) Data SThe typical sequencing data covering the shRNA expression element, the full pshOK-basic plasmid sequence and their alignment file. (ZIP)Author ContributionsConceived and designed the experiments: XJW SQW. Performed the experiments: XJW YL HH XJZ PWX WH DDL. Analyzed the data: XJW YL SQW. Wrote the paper: XJW SQW.with the popular used vector pSuper. The HBV target sequence “GGUAUGUUGCCCGUUUGUCCU” and the Gluc
The Notch pathway is evolutionarily conserved with an important role in the processes such as cell proliferation, cell fate decision, differentiation and stem cell maintenance. Due to its fundamental role in stem cells[1], it has been speculated during the recent years that Notch family may have critical functions in cancer stem cells or cancer cells with a stem cell phenotype, therefore playing an important role in the process of epitheli.